Busch Lab

ZMP

usp46

Ensembl ID:
ENSDARG00000045343
ZFIN ID:
ZDB-GENE-070705-213
Description:
Ubiquitin carboxyl-terminal hydrolase 46 [Source:UniProtKB/Swiss-Prot;Acc:A5WWB0]
Human Orthologue:
USP46
Human Description:
ubiquitin specific peptidase 46 [Source:HGNC Symbol;Acc:20075]
Mouse Orthologue:
Usp46
Mouse Description:
ubiquitin specific peptidase 46 Gene [Source:MGI Symbol;Acc:MGI:1916977]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa15815 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15815
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066678 Nonsense 149 375 5 11
ENSDART00000132093 Nonsense 145 370 4 9
Genomic Location (Zv9):
Chromosome 20 (position 23091924)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 23205311
GRCz11 20 23104411
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTTGAACACGGTGGCKGATATCCTGCAGGAGGAGAGAAAACAGGAGAAG[C/T]AGAACGGACGAYTGAARAACAACGGCACTGCCATCGCCACAGACACAGAG
Long Flanking Sequence:
AGTTTAAAATTATGTCAGTTTATGGTTCTGTTATCTGTTGTTTGTGTTAGGTTTAAATTAAGCTCATATCAATTCTTTGCAACCACTTAACTAAAAAATAATTAATAATTGTTTTTAGTGTACAGTGGCCTTCCACCATTGTTGTTTTGGTTTTCAAGTGCTCGCAGATGCTTGTAGCCTGAACACATACTGCAATGCTAATGCGCATATGGATCAACATTTTCACTAAATCTTGTTCCCATAGCTTAAGCTTATTTTATTTTGAGGCTTCCAAAAGGCTAATGCAGTGTAAATAAATGGCCAAAGCAAGTAAAAGGTTTTCCATTTGCTACATAAATGGTTGCTTTGTCCACAGATGCTAGCTAATTTTGCGTTTTTGCTCTCTGGCTCCTCCCCTAGACCTGTTTGATAACTACATGCAGCAAGATGCGCACGAGTTCCTGAATTACCTGTTGAACACGGTGGCTGATATCCTGCAGGAGGAGAGAAAACAGGAGAAG[C/T]AGAACGGACGACTGAAGAACAACGGCACTGCCATCGCCACAGACACAGAGCCGGAGCAGAACAAAATCGACCCAACCTGGGTTCATGAGATCTTCCAGGGCACACTGACCAATGAGACGCGCTGTCTCAACTGTGAGACGGTACGAGGGTCCTGATACATCGAGGGTTTACTAAAGTAGTTAGTTTAATATAGGAATTGATTGTTTGAAGTTGCTGCTGATTTAAAATTCTGGCAGATTGTGCAAGGTTTTTATCATTTTAGGGGCCGATCACACCGAATGCACTTCTACGTGCCAAAAACGCGAGACAAACCTTACTTCCTTTTTTGTTGACAAGAGAAAAAGAATTGTGGTGTGCATTTTATGTCGCTAGGCAAAGACTGAATCAGCTGTGTATTGTGCACAAGTGTTGCTGTTGACATTAAAGGTGCAGAAGGTTATCTGCCAAAATGCTAACCGGCTAGCATATTATCTTTGGACTGCAGAGAAGGGACTGATTTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7932
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066678 Essential Splice Site 221 375 6 11
ENSDART00000132093 Essential Splice Site 217 370 5 9
Genomic Location (Zv9):
Chromosome 20 (position 23094456)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 23207843
GRCz11 20 23106943
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACTTGTCTGTAGATGTTGAGCAGAACACTTCAATAACACACTGTCTCAGG[T/C]AGACATATGCACAAACACAAAACGCATAACATTAATCACACATGCTGATG
Long Flanking Sequence:
AAACATATGTGATCATGTGTAATGGTTTTTGCTAAATCATTATGAGTGGTCATTCGTTTGAACTTTGCTATTTGATGAAACTAACTTTGGTTTCTCTGCCGTGTGGCCCACTTTCCAGTCTTCATTTAACCTACTTTTTTCCGCATTAGCACTCTACTGCTCAAGTACAGTGGAGTGCTAACACCATATCACACCTTCGCTCGCATCTTTCTGCAATAAGTGCAAAACAACAGGAGACAATCAGGTCATCAGAGTTCAGCCCATTCTGCTGAAACACTCCATAGAAAAAGGTTTTCGGAGAAATGACTTTCCCACTAACACTCAGAGACGGCTAATATTGTCTCTGTGGGAAAGAAGATCACGATTTCTGAAGAGATGTGTTTTCTCTTCTTTGTGAACTTACATGCTCTCTGTTTCTGCAGGTCAGTAGCAAGGATGAAGACTTCTTGGACTTGTCTGTAGATGTTGAGCAGAACACTTCAATAACACACTGTCTCAGG[T/C]AGACATATGCACAAACACAAAACGCATAACATTAATCACACATGCTGATGCGCATAACTAGCTTATTTCCACCGGCGTTCATGTGTGTTTTGTCTAATGGTGTTGTTTACAGGGACTTCAGTAATACAGAGACCCTGTGCAGCGAGTATAAATACTACTGTGAGATGTGCTGTAGCAAACAAGAGGCACAGAAACGGTGAGTAATATTGCAAATCAGCCTTTTAACAACTATAGCTAACTGCTTAGATCCAGAGTGCCCAAACTTTTTTGTATGAAGGGCCAACTACCAAATATCATTATGAGCCCTGTGCCAAAGGTAAATTTACCAAACTGTATTACATAAAAATTGCCATGGGTAATTTCCTAATTTATTTAATAATTTTTCAAAGTAAATAGAAAACATTACTTTAAATTGTATTAACTAAATGCAGTATATATTTTTTTAAATTAGAACTTATTGTAATAAAACAAAAACAATCACATTTATAACACAGTGGAGT
Associated Phenotype:
Not determined