Busch Lab

ZMP

pkp4

Ensembl ID:
ENSDARG00000045331
Human Orthologue:
PKP4
Human Description:
plakophilin 4 [Source:HGNC Symbol;Acc:9026]
Mouse Orthologue:
Pkp4
Mouse Description:
plakophilin 4 Gene [Source:MGI Symbol;Acc:MGI:109281]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa11665 Nonsense Available for shipment Available now
sa1487 Nonsense Available for shipment Available now
sa40649 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26697
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110998 Essential Splice Site 44 1134 1 21
Genomic Location (Zv9):
Chromosome 6 (position 12187619)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 12040841
GRCz11 6 12275699
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGATACCACCACCACCACCACCAACCTGCTGGCCTCGGTTAAAGAGCAG[G/A]TAAAGTGCACCGCCTCCATCTGCCAGTGTCTTGACTGTGGAGAGCTGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11665
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110998 Nonsense 68 1134 2 21
Genomic Location (Zv9):
Chromosome 6 (position 12181837)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 12035059
GRCz11 6 12269917
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TYACCAGAGAACTCGARGAGGAGAGACAGATTGTAGCCAATCAGTTGGAG[C/T]GATGCAGGTTGGGGGCGGAGTCTCCAGGTGCTGCAAGTGACAGGTAAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1487
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110998 Nonsense 407 1134 8 21
Genomic Location (Zv9):
Chromosome 6 (position 12144659)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 11997881
GRCz11 6 12232739
KASP Assay ID:
554-1412.1 (used for ordering genotyping assays)
KASP Sequence:
CTGCTCTCTCACTCAGGGTTTGGTACTTTACAAAGGACCACGAGTCAGTG[T/A]AGCACTCTRAGGTACCAGCGAGGGTTATTCTCTATGGGCTCCATGGCAAC
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa40649
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110998 Essential Splice Site 855 1134 15 21
Genomic Location (Zv9):
Chromosome 6 (position 12124932)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 11978154
GRCz11 6 12213012
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTGCGTTACGAAACATGGCTCTGGACGCCAGGAACAAAGAGCTCATCGG[T/G]CAGTCACTCAAACCTATTGCTACCAACTTTCTTACATTCCCTTTTTTATT
Associated Phenotype:
Not determined