Busch Lab

ZMP

gsnb

Ensembl ID:
ENSDARG00000045262
ZFIN ID:
ZDB-GENE-030131-8567
Description:
gelsolin b [Source:RefSeq peptide;Acc:NP_001082813]
Human Orthologue:
GSN
Human Description:
gelsolin [Source:HGNC Symbol;Acc:4620]
Mouse Orthologue:
Gsn
Mouse Description:
gelsolin Gene [Source:MGI Symbol;Acc:MGI:95851]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa33746 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa33746
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047110 Nonsense 678 728 16 16

The following transcripts of ENSDARG00000045262 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 66495050)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 62601833
GRCz11 5 63295224
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCTTACCATGCATCTCTTTACATTTCTCAATTTAGCGGCCAAATACATC[G/T]AATCAGATCCTGCCGGTAGGGATAAGAGAACCCCTATTGTTACAGTGAAG
Associated Phenotype:
Not determined