Busch Lab

ZMP

zgc:110030

Ensembl ID:
ENSDARG00000045249
ZFIN ID:
ZDB-GENE-050706-80
Description:
NIF3-like protein 1 [Source:RefSeq peptide;Acc:NP_001025139]
Human Orthologue:
NIF3L1
Human Description:
NIF3 NGG1 interacting factor 3-like 1 (S. pombe) [Source:HGNC Symbol;Acc:13390]
Mouse Orthologue:
Nif3l1
Mouse Description:
Ngg1 interacting factor 3-like 1 (S. pombe) Gene [Source:MGI Symbol;Acc:MGI:1929485]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa13824 Nonsense Available for shipment Available now
sa35188 Nonsense Available for shipment Available now
sa15947 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27863
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066546 Essential Splice Site 119 347 None 7
ENSDART00000130693 Essential Splice Site 208 425 None 7
Genomic Location (Zv9):
Chromosome 12 (position 4556504)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 3839226
GRCz11 12 3875991
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGGACAGTGTTGAGGGAGGCGTTAATGACTGGCTTGTTGGAGGAATGGG[T/G]AAATACAGTGTTACATTTTCTTACTTGAGTAGGGTGACCATATGTGCCAT
Long Flanking Sequence:
TCTGTTTTCACTTCTTTTTTTGCATATTCAGCTCTCCCACGTTTCTCTCTCCATCACTCTCATCTCTCAGCATCCTGTTATCCTGCACTGAGCTCTGACAGAACGATCCGTTTTCTCTCTGCATCCACTCGTCCTGCCGAACACATGGATTTAAAGGGAGTTCTGGAGGTTTTGGAACAGCTCGCTCCATTATCATTGGCTGAATCCTGGGATAATGTTGGCCTATTGGTGGAACCTAGTAGACCTCGTCCAATCAAAACAATCCTGCTCACTAATGACCTGACGGCGGCGGTCATGGATGAAGCTGTAGGGATGAAGTGTGATCTGATCGTCTCCTACCATCCGCCACTCTTTCGGCCTTTCAAGCGTTTGCTGCAGAAGGACTGGAAGCAGCGTTTGGCAGTCAGAGCAATCGAAAACGGCATTGGCATTTTCTCCCCACACACTTCATGGGACAGTGTTGAGGGAGGCGTTAATGACTGGCTTGTTGGAGGAATGGG[T/G]AAATACAGTGTTACATTTTCTTACTTGAGTAGGGTGACCATATGTGCCATTTAAAAATTAAAATCATTGTACGAATAAAAATGTTAACGGTCAAAAAAATTATAATATAAAAAGTATACACACAGTTGAAGTCAGAATTATTAGCCCCACTTAGATTTTTTTCTTCTTTTTTTTAAACATTTCACAAATGATGTTTAACAGAGCAAGGAAATTTTCACAGTATGTCTGATAATATTTTTTCTTCTGGAAAAAGTCTTATTTGTTTTATTTTGGCTAGAATAAAAGCAGATTTTAATTTTTTAAACACCATTTTAAGGTCAAGATTATTAGCCCCTTTAAGCTATATATTTTTTGATATATTTGCATATATATTACCCTAACTTGCCTAATTAACCTAGTTAAGCCTTTAAATGTCACTTTAAGCTGTATAGAAGTGTCTTGAAGAATATCTAGTCAAATATTATGTGCTGTCATCATGACAAAGATAAAATAAATCAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13824
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066546 Nonsense 153 347 3 7
ENSDART00000130693 Nonsense 242 425 2 7
Genomic Location (Zv9):
Chromosome 12 (position 4558507)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 3841229
GRCz11 12 3877994
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACACAGGATTGARTTCTCATGCAYGGAYGAYGGAGAASTAARCAGCCTTT[T/A]GGAGCAGCTGAGACACACAGAGGGCAGCGAAACCTTTCAGTGCACTAGAA
Long Flanking Sequence:
GCTAAACTAGGCAGGTTATGGTAATCAGGCAAGTTATTGTGTAATGATGGTTTGTTCTGTAGACTATCAAAAAAATATTGCTTAAAGGGGCTATTAATTTTGACTTTCTTAATTAAGACTTTCTTATATAAATAATAATAAAAAACAAATAAATTAATTAAATTCAAAATAAAAAAAATTTTGATTGTGGAAATCCAGCAAATCAAGCAGGCAGGAGAGTCGTTTAGGATGCTGCTGCAGTTCTAGTTAAATTAAAGCTTATTTTGAAAACTTAAGTTCAGTTTAACGTAAATATCACTGTTGAAGGATGATGATAAAGCGAAATATAGAAAACCTGGCCAGGATGTGCCTTAAAATGAGAACTCATGGTCACCCTGTGCTTGTGTCTTTTTCCACAGGTAGAGGTAAAGTGTCGGTATTAAGTCAAGCAGTCTCTAGCGGTGCACAGAAACACAGGATTGAGTTCTCATGCATGGATGATGGAGAAGTAAACAGCCTTT[T/A]GGAGCAGCTGAGACACACAGAGGGCAGCGAAACCTTTCAGTGCACTAGAATAAAGTGAATATACATAAGCATGCACAATATATTATTTTAGCATTCATATTACAATGTGTGTGCGTGCGCAAAAGACAGAATTATAGCTACACGCTGTGAAAAAATATCTGTAAATTAGCAGTTTTCCATATTTTGAGATTCATGTTTTTATTTTGGGCGAAGCAGTGGTGCTGTGGCCTCACAGCAAGAAGGTCGCTGGTTCGAGCCTCGGCTCAGTTGGCATTTCTGTGTGGAGTTTGCATGTTCTCCCTGCGTTCGCGTGGGTTTCCTCCGGGTGCTCCGGTTTCCCCCACAGTCCAAAGACATGCGGTACAGGTGAATTGGGTAGGCTAAATTGTCCGTAGTGTATGAATGTGTGTGTGGATGTTTCCCAGGTATGGGTTGCGGCTGGAAGAGCATCCGCTGCATAAAAACTTGCTGGAGAAGTTGGCGGTTCATTCCGCTGTGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35188
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066546 Nonsense 155 347 3 7
ENSDART00000130693 Nonsense 244 425 2 7
Genomic Location (Zv9):
Chromosome 12 (position 4558512)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 3841234
GRCz11 12 3877999
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGATTGAGTTCTCATGCATGGATGATGGAGAAGTAAACAGCCTTTTGGAG[C/T]AGCTGAGACACACAGAGGGCAGCGAAACCTTTCAGTGCACTAGAATAAAG
Long Flanking Sequence:
ACTAGGCAGGTTATGGTAATCAGGCAAGTTATTGTGTAATGATGGTTTGTTCTGTAGACTATCAAAAAAATATTGCTTAAAGGGGCTATTAATTTTGACTTTCTTAATTAAGACTTTCTTATATAAATAATAATAAAAAACAAATAAATTAATTAAATTCAAAATAAAAAAAATTTTGATTGTGGAAATCCAGCAAATCAAGCAGGCAGGAGAGTCGTTTAGGATGCTGCTGCAGTTCTAGTTAAATTAAAGCTTATTTTGAAAACTTAAGTTCAGTTTAACGTAAATATCACTGTTGAAGGATGATGATAAAGCGAAATATAGAAAACCTGGCCAGGATGTGCCTTAAAATGAGAACTCATGGTCACCCTGTGCTTGTGTCTTTTTCCACAGGTAGAGGTAAAGTGTCGGTATTAAGTCAAGCAGTCTCTAGCGGTGCACAGAAACACAGGATTGAGTTCTCATGCATGGATGATGGAGAAGTAAACAGCCTTTTGGAG[C/T]AGCTGAGACACACAGAGGGCAGCGAAACCTTTCAGTGCACTAGAATAAAGTGAATATACATAAGCATGCACAATATATTATTTTAGCATTCATATTACAATGTGTGTGCGTGCGCAAAAGACAGAATTATAGCTACACGCTGTGAAAAAATATCTGTAAATTAGCAGTTTTCCATATTTTGAGATTCATGTTTTTATTTTGGGCGAAGCAGTGGTGCTGTGGCCTCACAGCAAGAAGGTCGCTGGTTCGAGCCTCGGCTCAGTTGGCATTTCTGTGTGGAGTTTGCATGTTCTCCCTGCGTTCGCGTGGGTTTCCTCCGGGTGCTCCGGTTTCCCCCACAGTCCAAAGACATGCGGTACAGGTGAATTGGGTAGGCTAAATTGTCCGTAGTGTATGAATGTGTGTGTGGATGTTTCCCAGGTATGGGTTGCGGCTGGAAGAGCATCCGCTGCATAAAAACTTGCTGGAGAAGTTGGCGGTTCATTCCGCTGTGGCGACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15947
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066546 Nonsense 284 347 6 7
ENSDART00000130693 Nonsense 373 425 5 7
Genomic Location (Zv9):
Chromosome 12 (position 4565871)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 3848593
GRCz11 12 3885358
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTGCYGGTTCTGGAGCTTCTGTCATACAAGGAGYAACAGCAGACCTCTA[C/A]ATCACTGGTACGTCACAGACATCAAAAAAGSAATTTAYTATCAATTTATA
Long Flanking Sequence:
ATTTTCAGTTTTGGGTGAACTATCCCTTTAGGGCCAATTCAAACCAAGATTAAGCACACAGCACCAATAACCGTAGGATGATAACTGTTTATGAAATGCACACTCTGCAGTTTTTAGGTGATAGAATAATAATTGCATGTTAAATGCACATAGGTATGTGTATTAGATGTTTATTTCTTACAAAAAACAGTTAGCTTTTTTATTCCCTCTTGTATGTTTTAAAAGTTAGAAAGAAATAAAGCTACAATTTTATTTATTCAGAAACTGAAGTAATTAACGAATAAATAATTGTATTGTATTGCATTTAGAGTGATTTTTAAAAGTCTATCTTTGTAATTTCCATTATTTTCATGGCTTTGCGTATTGAATAATAGTCCAGAGTTACATAATCCTCAATAAGCGCATTATTTATGTGATGTTGTAGACTCGATGGTGAAGACGGTTGCAGTGTGTGCCGGTTCTGGAGCTTCTGTCATACAAGGAGTAACAGCAGACCTCTA[C/A]ATCACTGGTACGTCACAGACATCAAAAAAGGAATTTATTATCAATTTATAAGTGATAGAACAACAAATAACAACAGTTCCTAATGCAAACAAACTAGGTGATATTTTAAGGTGTCAGTAGCCTCTTTCACATATATAGACCTTTCCGGAAAATTACTGGCAATTTTCCGGAAAGGTCTATATATACAGTTAAAGTCAGAATTATTAGCCCCCTTGAATTATTTTTTCCCCAATTTCTGTTTAACGGAGGGAAGATTTTTTTTTCAACACATTTCTAAACATAATAGTTTTAATATCTCATTTCTAATAACTGATTTATTTTATCTTTGTCATGATGACAGTAAATAATATTTGACTAGATATTTTTCAAGACACTTCTATACAGCTTAAAGTGACATTTAAAGGCTTAACTAGGTTAATTAGGTTAACTAGGCAGGTTAGGATAATTAGGCAAGTTACTGTATAACGATGGTTTGTTCTGTAGACTATCAAAAATAATTT
Associated Phenotype:
Not determined