Busch Lab

ZMP

dkk1b

Ensembl ID:
ENSDARG00000045219
ZFIN ID:
ZDB-GENE-990708-5
Description:
dickkopf-related protein 1 [Source:RefSeq peptide;Acc:NP_571078]
Human Orthologue:
DKK1
Human Description:
dickkopf homolog 1 (Xenopus laevis) [Source:HGNC Symbol;Acc:2891]
Mouse Orthologue:
Dkk1
Mouse Description:
dickkopf homolog 1 (Xenopus laevis) Gene [Source:MGI Symbol;Acc:MGI:1329040]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa27882 Essential Splice Site, Splice Site Mutation detected in F1 DNA Not yet available
sa27883 Nonsense Mutation detected in F1 DNA Not yet available
sa16096 Nonsense Available for shipment Available now
sa9337 Nonsense Mutation detected in F1 DNA Not yet available
sa19025 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa27882
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Essential Splice Site, Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066477 Essential Splice Site 65 241 2 4
ENSDART00000122271 Splice Site None 240 None 4
Genomic Location (Zv9):
Chromosome 12 (position 7149648)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 6432379
GRCz11 12 6465882
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGTCAGACAGCTGGTGGTTTTTAGACTAATAGTGTATTTCCAAACCTCC[A/G]GCAGCCTTTAATCTGTGAGAGTGATGAGGAATGCGGTGGAGAGGAGTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27883
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066477 Nonsense 145 241 3 4
ENSDART00000122271 Nonsense 144 240 3 4
Genomic Location (Zv9):
Chromosome 12 (position 7149997)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 6432728
GRCz11 12 6466231
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGAAGAGTTCGTGTCCATCGCCCATGAAAACTCTACTGCTCTAATGCCG[A/T]AAGTTTCGACTCAAGGATCACCACAAAACCAGATGCTGAAAGGTATGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16096
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066477 Nonsense 202 241 4 4
ENSDART00000122271 Nonsense 201 240 4 4
Genomic Location (Zv9):
Chromosome 12 (position 7150953)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 6433684
GRCz11 12 6467187
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCTGCAAGCCTGTCCTAAAAGAGGGCCAGGTCTGCACCAAGCACAAGAGG[A/T]AAGGCACTCATGGCTTGGAGATATTCCAGCGCTGCGACTGCGGGGAAGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9337
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066477 Nonsense 222 241 4 4
ENSDART00000122271 Nonsense 221 240 4 4
ENSDART00000066477 Nonsense 222 241 4 4
ENSDART00000122271 Nonsense 221 240 4 4
Genomic Location (Zv9):
Chromosome 12 (position 7151013)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 6433744
GRCz11 12 6467247
KASP Assay ID:
2260-4949.1 (used for ordering genotyping assays)
KASP Sequence:
ATGGCTTGGAGATATTCCAGCGCTGCGACTGCGGGGAAGGCCTGTCCTGC[A/T]GAACGCAGCGAGGAGACGGCGGCAAGGCTTCACGGAGTCTGCACACRTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19025
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066477 Nonsense 222 241 4 4
ENSDART00000122271 Nonsense 221 240 4 4
ENSDART00000066477 Nonsense 222 241 4 4
ENSDART00000122271 Nonsense 221 240 4 4
Genomic Location (Zv9):
Chromosome 12 (position 7151013)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 6433744
GRCz11 12 6467247
KASP Assay ID:
2260-4949.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGGCTTGGAGATATTCCAGCGCTGCGACTGCGGGGAAGGCCTGTCCTGC[A/T]GAACGCAGCGAGGAGACGGCGGCAAGGCTTCACGGAGTCTGCACACATGC
Associated Phenotype:
Not determined