Busch Lab

ZMP

dlgap5

Ensembl ID:
ENSDARG00000045167
ZFIN ID:
ZDB-GENE-040912-160
Description:
disks large-associated protein 5 [Source:RefSeq peptide;Acc:NP_001004592]
Human Orthologue:
DLGAP5
Human Description:
discs, large (Drosophila) homolog-associated protein 5 [Source:HGNC Symbol;Acc:16864]
Mouse Orthologue:
Dlgap5
Mouse Description:
discs, large (Drosophila) homolog-associated protein 5 Gene [Source:MGI Symbol;Acc:MGI:2183453]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa17993 Nonsense Available for shipment Available now
sa11350 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2665
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066411 Nonsense 143 909 4 20
ENSDART00000143342 None None 142 None 4
Genomic Location (Zv9):
Chromosome 12 (position 18720426)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 17531003
GRCz11 12 17652877
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAATCTTAYTTTTTTCTTCATGACAGGCCACAGAAATGAATCAGTCTACA[C/T]GAATKACCCGMTCGATGGTGCAGAATCAAAAGGTATCRTTTAAAATGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17993
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066411 Nonsense 230 909 8 20
ENSDART00000143342 None None 142 None 4
Genomic Location (Zv9):
Chromosome 12 (position 18718187)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 17528764
GRCz11 12 17650638
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AWGTGCTTKTTAGATACAAGAGGTCCCAAAACAAGATCAGYTGTTAAATA[T/A]CCTGCAGCKCCCTCTTCAGGMAGAGGGAAARTCRYACAAGGTAATGAGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11350
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066411 Nonsense 405 909 12 20
ENSDART00000143342 None None 142 None 4
Genomic Location (Zv9):
Chromosome 12 (position 18713458)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 17524035
GRCz11 12 17645909
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGGCCAGYGAGACTGAGCGTTTGACTGGGCTCTCTGAGCTGTGGGAGTCA[C/T]GATTTGATGACRCYTCTATACCAGAGGAGAGTAAGTCTTCARTTTTGACC
Associated Phenotype:
Not determined