Busch Lab

ZMP

NP_001165055.1

Ensembl ID:
ENSDARG00000045164
Description:
neuronal pentraxin 2b [Source:RefSeq peptide;Acc:NP_001165055]
Human Orthologue:
NPTX2
Human Description:
neuronal pentraxin II [Source:HGNC Symbol;Acc:7953]
Mouse Orthologue:
Nptx2
Mouse Description:
neuronal pentraxin 2 Gene [Source:MGI Symbol;Acc:MGI:1858209]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa13823 Nonsense Available for shipment Available now
sa42006 Nonsense Mutation detected in F1 DNA Not yet available
sa27934 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa13823
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066407 Nonsense 16 426 1 5
Genomic Location (Zv9):
Chromosome 12 (position 18924354)
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAAATGCTTCATCTGATCGCCGGACTCATTTGCGTCTATGGACTTACGTG[T/A]GTMAAAGTTGTTTACGGACAAACCGAGAAAGGGGAGCGTTTTCTGYGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42006
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066407 Nonsense 91 426 1 5
Genomic Location (Zv9):
Chromosome 12 (position 18924131)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 17774990
GRCz11 12 17896864
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAATTGTCAACCAGCTGGGAACAATTAAAGAACTGACTTCTAAACTTTCA[C/T]GATGTGAGTCTGAATCGGAAATATTCCGGAAAATGAATAAGGACACAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27934
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066407 Nonsense 137 426 2 5
Genomic Location (Zv9):
Chromosome 12 (position 18921773)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 17772667
GRCz11 12 17894541
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAATATCCACAATCATCCTTGTAATTTATTTTTTGTTTAACTTTTAAAG[C/T]AACAGCAAATGCGAGCCAATGCCTCTGGTGCCTCCTTCCCTAATGAGCTG
Associated Phenotype:
Not determined