Busch Lab

ZMP

OPLAH

Ensembl ID:
ENSDARG00000045123
Description:
5-oxoprolinase (ATP-hydrolysing) [Source:HGNC Symbol;Acc:8149]
Human Orthologue:
OPLAH
Human Description:
5-oxoprolinase (ATP-hydrolysing) [Source:HGNC Symbol;Acc:8149]
Mouse Orthologue:
Oplah
Mouse Description:
5-oxoprolinase (ATP-hydrolysing) Gene [Source:MGI Symbol;Acc:MGI:1922725]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa15238 Essential Splice Site Available for shipment Available now
sa35231 Nonsense Available for shipment Available now
sa22054 Essential Splice Site Available for shipment Available now
sa1644 Nonsense F2 line generated Not yet available

Mutation Details

Allele Name:
sa15238
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066359 Essential Splice Site 121 1291 2 26
Genomic Location (Zv9):
Chromosome 12 (position 14763346)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 13618999
GRCz11 12 13657302
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
RGACTTGCTACATATCGGAACCCAAGCACGGCCTAACCTTTTTGATTTGG[T/A]GAGTTTTGGTTGCTATGTAGATTTTTCCCAGTGACTTAATTGTTYTAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35231
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066359 Nonsense 241 1291 5 26
Genomic Location (Zv9):
Chromosome 12 (position 14776800)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 13632453
GRCz11 12 13670756
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTGAGGTGATGCCCATGGTGCGAGCAGTGCCCCGTGGGTATACAGTTTG[T/A]GCCGATGCCTACCTCACACCAAAAATACACCTGTACCTGACTAAATTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22054
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066359 Essential Splice Site 266 1291 5 26
Genomic Location (Zv9):
Chromosome 12 (position 14776877)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 13632530
GRCz11 12 13670833
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACACCTGTACCTGACTAAATTTACTGCAGGCTTTAAAGGAGGCTTGAAGG[T/C]ATGTCTGTGTGGTTTGTTTAATCAATCATATACAGTTGAAGTCAGAATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1644
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066359 Nonsense 631 1291 13 26
Genomic Location (Zv9):
Chromosome 12 (position 14790808)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 13646461
GRCz11 12 13684764
KASP Assay ID:
554-1584.1 (used for ordering genotyping assays)
KASP Sequence:
TATGCTTATCTGACTTTTACTCTTTCTTTATCTACATCAGATATCTGAAA[G/T]AGTTTGGCTTCACTATCACTGATAGGCCTATCATGGTGGATGATATCCGT
Associated Phenotype:
Not determined