Busch Lab

ZMP

si:dkey-222b8.1

Ensembl ID:
ENSDARG00000045094
ZFIN ID:
ZDB-GENE-060503-248
Description:
hypothetical protein LOC560317 [Source:RefSeq peptide;Acc:NP_001038388]
Human Orthologue:
SMAD4
Human Description:
SMAD family member 4 [Source:HGNC Symbol;Acc:6770]
Mouse Orthologue:
Smad4
Mouse Description:
MAD homolog 4 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:894293]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa13043 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13043
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047862 Essential Splice Site 264 547 None 14
ENSDART00000139040 Essential Splice Site 288 571 None 11
Genomic Location (Zv9):
Chromosome 19 (position 24442520)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 24372632
GRCz11 19 23956855
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AATGGCTACAATAGCTCCAAACACTCCCAGACGCAAGGCTCCTTTCACAG[T/C]CAGTATTACGCATAGAATAAAGCAMCCACCCTAATTAACTGATACCCAGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29205
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047862 Nonsense 386 547 10 14
ENSDART00000139040 Nonsense 410 571 9 11
Genomic Location (Zv9):
Chromosome 19 (position 24450902)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 24381014
GRCz11 19 23965237
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTTGATTTGTCTGCAGGTTGCACATAGGTAAAGGCGTGCAGCTGGAGTG[T/A]CGTGGTGAGGGGGATGTATGGATGCGCTGTATGAGCGATCATGCCGTCTT
Associated Phenotype:
Not determined