Busch Lab

ZMP

cdkrap3

Ensembl ID:
ENSDARG00000045092
ZFIN ID:
ZDB-GENE-040625-90
Description:
CDK5 regulatory subunit-associated protein 3 [Source:RefSeq peptide;Acc:NP_001002105]
Human Orthologue:
CDK5RAP3
Human Description:
CDK5 regulatory subunit associated protein 3 [Source:HGNC Symbol;Acc:18673]
Mouse Orthologue:
Cdk5rap3
Mouse Description:
CDK5 regulatory subunit associated protein 3 Gene [Source:MGI Symbol;Acc:MGI:1933126]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa7362 Missense Mutation detected in F1 DNA Not yet available
sa22121 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27970
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066304 Essential Splice Site 95 507 4 14
ENSDART00000133703 Essential Splice Site 95 509 4 14
Genomic Location (Zv9):
Chromosome 12 (position 30374876)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 28711813
GRCz11 12 28826715
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCGTCCACCAAAAATATTTTTGGCAGATATTCATCACAAAGGATGAAGG[T/C]GCTGTTTATTTGCATTTTAATGTGCAGTTTATTACACTTAACATTGTACA
Long Flanking Sequence:
ACTCTTGGGTGAGACTGCTTTATACTCATTTGTGCAGGTTTAACTTAGACTTATTATCATGCGATTTGTAGCTATATTGTTAGCTAAATGTGGCTCAGCTTGAATAAACAACAGCTTAGATCTTGCACAGATGTAATGTCTTATTCCTCTTCTTCTACTTTTTCCTCTTCCTCTCCTCTATATTTTAGACTGGTTGGTGGACCGAAGACACTGCACACTGAAATGGCAAAGTGCAGTTATGACCATCAGAGAGAAAATTAACGCTGCCATTCAGGATATGCCAGAAAACGAAGAGATCAAACAGCTGCTCTCCGGCTCATGTAAAGAAAAAGTTATATATTCCTGTTATTTGTATTTTATTTAATTTTGGATCTACTCATACTGAATTATTGTTGCAGATATTCACCATTTCCATTGCTTACAAATAATCGAAGTATTAAAAGGAACGGAAGCGTCCACCAAAAATATTTTTGGCAGATATTCATCACAAAGGATGAAGG[T/C]GCTGTTTATTTGCATTTTAATGTGCAGTTTATTACACTTAACATTGTACATAGTCTACATACTTATTATTACTAATAAAATATCCTCAATTTCTATAACATATACTATGGAAAATAAAAACATGAGACCGCTTAAAAATTCTCAGTGTCTCTGGATTTACAATTTAAAGTTGTATGACTGGGGAAAAACCTAATTTTCATTTTATTCTGTAAACTACTAATAGCTTTTATACCATAATAGCGATATTTTAAATTCAGCAGAGTTAAGGAATAAGTATTTCTAAGTTGTGTTTTTTTCTCTTTGTACTATTTAGAAGAAATGCTGTCAGTTTACTCAAACCCATACCTAGAAATGGCAAAACTCCAGAGAAGCAAAGAATGTTTAAGTGGCCCTTAATGTTTCCATTAATGTATATTTATCAACTCTGAAGTCTGAACTTTACTAAACTTCTATCTTAAGCTGCTTTGACACAATCTACATTGTAAAAGCGCTATATAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7362
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066304 Missense 146 507 6 14
ENSDART00000133703 Missense 146 509 6 14
Genomic Location (Zv9):
Chromosome 12 (position 30375681)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 28712618
GRCz11 12 28827520
KASP Assay ID:
554-4222.1 (used for ordering genotyping assays)
KASP Sequence:
TAAGGAAGCAGGTGTCTAAAGCTCAACAGCTGCAGCAGGAGCTGAGCCGA[C/T]GTGAGCTGGAGTGTCAGAGCGGTTCTGCCGACWTGAGAGAACGCTATTAT
Long Flanking Sequence:
ACTATTTAGAAGAAATGCTGTCAGTTTACTCAAACCCATACCTAGAAATGGCAAAACTCCAGAGAAGCAAAGAATGTTTAAGTGGCCCTTAATGTTTCCATTAATGTATATTTATCAACTCTGAAGTCTGAACTTTACTAAACTTCTATCTTAAGCTGCTTTGACACAATCTACATTGTAAAAGCGCTATATAAATAAACATGAATTGAATTGAATATTTACATATATTTAATTAACTGTAATATACTTTATCAACAGGACTGGCAAGAGATAGTATCCATGTATGAAAAAGACAATGTCTATTTGGGTAAGCAATCATCAAATCACCATTTTTTTTTTTAATTTTAGACTACACAATCAAAGTGAGATGATAGTATGCATGTGTGTTTTTAATTCCAGCTGAAATGGCCAGTATTTTGGTTCGTAATGTGAGTTATGAAGGGCCAGCTTTAAGGAAGCAGGTGTCTAAAGCTCAACAGCTGCAGCAGGAGCTGAGCCGA[C/T]GTGAGCTGGAGTGTCAGAGCGGTTCTGCCGACTTGAGAGAACGCTATTATGCTGCCTGTAAACAGTACGGCATAAAAGTGAGCTATGATGGTCATTTATTGTAACATAATGGCTTTTACACATACTAACAAATAACATTTGTGTTTCACAGGGGGAAAACGTGGCAAGGGAGTTGCAAGCACAGGTTAAAGATCTGCCTGTGGTTTTAGAAGAAACTGGAAAAAAAGCTGCCTGTCTGAAAGATGCCATAGAGTTTTACACAGCATTCACTAAGTTTGTCAGCGACTGGCAAGTGTTACTTTCATTTCTAATGTTGCACCTGATTCTTTTAATTGATATTGTGAAATGTTTGTCATAGTTTACTTGCTTTTTCAGGTCAGAGGAAGTACTGCCCTTACTGAGGTTTGTCCAGAAGAAAGGAAACACAACTGTATATGAGAGAAAGACTGGAAATGTGCCTAAAGTTGTAGAGAGACCTGTAATGGAGGAAGCACCACCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22121
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066304 Nonsense 180 507 7 14
ENSDART00000133703 Nonsense 180 509 7 14
Genomic Location (Zv9):
Chromosome 12 (position 30375857)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 28712794
GRCz11 12 28827696
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAACAAATAACATTTGTGTTTCACAGGGGGAAAACGTGGCAAGGGAGTTG[C/T]AAGCACAGGTTAAAGATCTGCCTGTGGTTTTAGAAGAAACTGGAAAAAAA
Long Flanking Sequence:
TGTAAAAGCGCTATATAAATAAACATGAATTGAATTGAATATTTACATATATTTAATTAACTGTAATATACTTTATCAACAGGACTGGCAAGAGATAGTATCCATGTATGAAAAAGACAATGTCTATTTGGGTAAGCAATCATCAAATCACCATTTTTTTTTTTAATTTTAGACTACACAATCAAAGTGAGATGATAGTATGCATGTGTGTTTTTAATTCCAGCTGAAATGGCCAGTATTTTGGTTCGTAATGTGAGTTATGAAGGGCCAGCTTTAAGGAAGCAGGTGTCTAAAGCTCAACAGCTGCAGCAGGAGCTGAGCCGACGTGAGCTGGAGTGTCAGAGCGGTTCTGCCGACTTGAGAGAACGCTATTATGCTGCCTGTAAACAGTACGGCATAAAAGTGAGCTATGATGGTCATTTATTGTAACATAATGGCTTTTACACATACTAACAAATAACATTTGTGTTTCACAGGGGGAAAACGTGGCAAGGGAGTTG[C/T]AAGCACAGGTTAAAGATCTGCCTGTGGTTTTAGAAGAAACTGGAAAAAAAGCTGCCTGTCTGAAAGATGCCATAGAGTTTTACACAGCATTCACTAAGTTTGTCAGCGACTGGCAAGTGTTACTTTCATTTCTAATGTTGCACCTGATTCTTTTAATTGATATTGTGAAATGTTTGTCATAGTTTACTTGCTTTTTCAGGTCAGAGGAAGTACTGCCCTTACTGAGGTTTGTCCAGAAGAAAGGAAACACAACTGTATATGAGAGAAAGACTGGAAATGTGCCTAAAGTTGTAGAGAGACCTGTAATGGAGGAAGCACCACCAGATGTTGTTACAGAGGAGACGGTAAGTCACTATTCAAGATTTTAAGTTGTTTTTTTTACTTAAACAAAGGATCAGTATTTTCTCTCCCTCCAGAATCTCACTGTTTTTCTTGGTTCTTGCAGATTGACTGGGGTGATCTTGGCAGCGGTGCTGGTACTGGTAGTGAAGAGGTAAATT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3826
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066304 Essential Splice Site 360 507 11 14
ENSDART00000133703 Essential Splice Site 362 509 11 14
Genomic Location (Zv9):
Chromosome 12 (position 30378330)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 28715267
GRCz11 12 28830169
KASP Assay ID:
2260-5498.1 (used for ordering genotyping assays)
KASP Sequence:
TCTGGAAAACTCACAAACACGTAGCCAGTTCATCAATGAACTAAAGGAGG[T/C]ACTGTTTTTTACTTRCATAAGTATTACACAGACTTTTTAATTSCTACMAG
Long Flanking Sequence:
TACTCACAGCACATGCAAATACAGAAATGCACTGCAAATAGCACAGACAACAACGAAAATGGGTCGGGGGACCTCAACATTTTTTATATTATATTATTAATTGATTGTTTATTAGATTTTATGGAGATGCACTCCCACTGCAGAATCATCCTAATCGATCTAACATAACAAATACTTTCCAACTAGAGATATTAAGTCATCTGGTGACTTAGATATATATAATTAAATTAAATTAAATTATAAAAATTTTTTTTTCCAATATTGTGCAGCCCTAGTCTAGAATCTAATTCACAGCCTGCAGATTACATATGAGCTGTCATCCAGTTCACAATACTTGTAATTCATTAGCTGCTGTATGGTAATTCTTATTTGAAAATAAAGGTGGGTAAGTAATACTTTGCCTCTTGAAGGTCCTGATGGTGTAGCCAGAGGTGAAGATGCCCTTTCTCTTCTGGAAAACTCACAAACACGTAGCCAGTTCATCAATGAACTAAAGGAGG[T/C]ACTGTTTTTTACTTACATAAGTATTACACAGACTTTTTAATTGCTACAAGACCATATCAAACTTATGTGATTCTTTGTGTTAGTTGGAAATGTTCCTGTGTCAGCGGCTCAGTGAGATGCGTGAAGAAGGCGACTTGGTGGCCATGAGTCAGTTCCAGCTCGCTCCCTCAGTGATCCAGGCCCAGACACCTCAACGTGTGCAGGTCATGCTGGCAGATGTGCGTGAGCTGCTGAACGGGCTCACTTCAGTGCGAATGCAGCACCTCTTCATGATCCAGGCATCACCACGGTAATTACACACTCTCAAATATCTCACACACTGAGAATGTACTTTTACCCTTGTGTGTTGTTGAGGATGTTTTCATCCACTTTGGTGAGCTTTTGAGTTTTAATTTGGCCACAACTTTCTCTGTTTCAGCAAATGGAAAGATTTTTGGTGACAACTCTTATTTTGACACATTTTTAGGGAAAATGCTTTAAAAAAAATTAACAATCCAGTT
Associated Phenotype:
Not determined