Busch Lab

ZMP

mrpl10

Ensembl ID:
ENSDARG00000045091
ZFIN ID:
ZDB-GENE-050320-19
Description:
39S ribosomal protein L10, mitochondrial [Source:UniProtKB/Swiss-Prot;Acc:Q5BJB7]
Human Orthologue:
MRPL10
Human Description:
mitochondrial ribosomal protein L10 [Source:HGNC Symbol;Acc:14055]
Mouse Orthologue:
Mrpl10
Mouse Description:
mitochondrial ribosomal protein L10 Gene [Source:MGI Symbol;Acc:MGI:1333801]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa12492 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12492
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066303 Nonsense 150 252 4 5

The following transcripts of ENSDARG00000045091 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 30345245)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 28682182
GRCz11 12 28797084
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGCATTTACGGTAACATGTCACCTCTAATTTTTGGCGAGACTGTCCTGT[T/A]AGCTAGTAAAGAGCCAAAAGTTAAAGAGATGCTGCAGGCATTGAGGCACA
Associated Phenotype:
Not determined