Busch Lab

ZMP

zgc:162738

Ensembl ID:
ENSDARG00000044925
ZFIN ID:
ZDB-GENE-070424-90
Description:
CDK5 regulatory subunit-associated protein 1 [Source:RefSeq peptide;Acc:NP_001103849]
Human Orthologue:
CDK5RAP1
Human Description:
CDK5 regulatory subunit associated protein 1 [Source:HGNC Symbol;Acc:15880]
Mouse Orthologue:
Cdk5rap1
Mouse Description:
CDK5 regulatory subunit associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:1914221]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa9397 Nonsense Mutation detected in F1 DNA Not yet available
sa35053 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa9397
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104111 Nonsense 76 577 1 13
Genomic Location (Zv9):
Chromosome 11 (position 15843105)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 15346320
GRCz11 11 15480955
KASP Assay ID:
2260-4083.1 (used for ordering genotyping assays)
KASP Sequence:
GATTTCATCATGAGTTCTGATAAAAGCGATTTTGACGGCAGTGAGGAATA[T/A]GAGGAGCACTATATTCCTAAAWACATGTCAGACCATTCACGGAAAGGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35053
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104111 Essential Splice Site 505 577 11 13
Genomic Location (Zv9):
Chromosome 11 (position 15929987)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 15433202
GRCz11 11 15567837
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTCAACATGACTCTTATCGGCAACACACAGCTTGTATTGGTAGAGGGAG[T/C]GAGTATAGCATCATACTTAATGAAGTTTTGCATATTTTTCGTCATTGCTT
Associated Phenotype:
Not determined