Busch Lab

ZMP

suclg2

Ensembl ID:
ENSDARG00000044914
ZFIN ID:
ZDB-GENE-030114-3
Description:
Suclg2 protein [Source:UniProtKB/TrEMBL;Acc:Q6PHH4]
Human Orthologue:
SUCLG2
Human Description:
succinate-CoA ligase, GDP-forming, beta subunit [Source:HGNC Symbol;Acc:11450]
Mouse Orthologue:
Suclg2
Mouse Description:
succinate-Coenzyme A ligase, GDP-forming, beta subunit Gene [Source:MGI Symbol;Acc:MGI:1306824]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa41804 Nonsense Mutation detected in F1 DNA Not yet available
sa27752 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa41804
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087520 Nonsense 305 354 8 9
ENSDART00000122222 Nonsense 305 432 8 11
ENSDART00000131079 Nonsense 292 341 8 11
Genomic Location (Zv9):
Chromosome 11 (position 17234507)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 16715207
GRCz11 11 16849842
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCGGCAAAATACGACCTCAAATACATCGGAATGGATGGAAACATCGCCTG[T/A]TTCGGTATGTTTTTAAACTTCCATAAAATTTACAAGATCATTAACAATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27752
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087520 Nonsense 322 354 9 9
ENSDART00000122222 Nonsense 322 432 9 11
ENSDART00000131079 Nonsense 309 341 9 11
Genomic Location (Zv9):
Chromosome 11 (position 17232581)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 16713281
GRCz11 11 16847916
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACAGTTAATGGTGCTGGCCTTGCTATGGCAACATGTGACATCATTGACT[T/A]GCATGGCGGGAAGCCGGCAAACTTCTTGGACCTGGGCGGAGGTGTAAAGG
Associated Phenotype:
Not determined