Busch Lab

ZMP

NOTC1_DANRE

Ensembl ID:
ENSDARG00000044841
Description:
Neurogenic locus notch homolog protein 1 [Source:UniProtKB/Swiss-Prot;Acc:P46530]
Human Orthologue:
NOTCH1
Human Description:
notch 1 [Source:HGNC Symbol;Acc:7881]
Mouse Orthologue:
Notch1
Mouse Description:
Notch gene homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:97363]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa43576 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa39316 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa43576
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046633 Essential Splice Site 1003 1655 14 20
ENSDART00000122949 None None 298 None 6
ENSDART00000129224 None None 422 None 9
Genomic Location (Zv9):
Chromosome 21 (position 5073334)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 4613026
GRCz11 21 4777591
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCAAAAAGAAGAGGAGAGAACCAGTGGGAGAGGACTCTGTCGGACTCAAG[T/G]CAGTTTCCACACACTTGCATGAGAGCTCTATATATTAATGCCATATATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39316
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046633 Essential Splice Site 1003 1655 15 20
ENSDART00000122949 None None 298 None 6
ENSDART00000129224 None None 422 None 9
Genomic Location (Zv9):
Chromosome 21 (position 5074078)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 4612282
GRCz11 21 4776847
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCACCTTTTATTACATGTAATGATGCTAACCTGTGACTCTGTGTTCCATC[A/G]GGCCTTTGAAAAACTCAGACAGCTCTCTGATGGATGAACAGCTGAGCGAA
Associated Phenotype:
Not determined