Busch Lab

ZMP

aadacl4

Ensembl ID:
ENSDARG00000044802
ZFIN ID:
ZDB-GENE-080919-2
Description:
arylacetamide deacetylase-like 4 [Source:RefSeq peptide;Acc:NP_001166113]
Human Orthologues:
AADACL3, AADACL4
Human Descriptions:
arylacetamide deacetylase-like 3 [Source:HGNC Symbol;Acc:32037]
arylacetamide deacetylase-like 4 [Source:HGNC Symbol;Acc:32038]
Mouse Orthologues:
9430007A20Rik, Aadacl3, Gm13124, Gm13177, Gm13178, Gm436, Gm438
Mouse Descriptions:
RIKEN cDNA 9430007A20 gene Gene [Source:MGI Symbol;Acc:MGI:2685880]
arylacetamide deacetylase-like 3 Gene [Source:MGI Symbol;Acc:MGI:2685281]
predicted gene 13124 Gene [Source:MGI Symbol;Acc:MGI:3652194]
predicted gene 13177 Gene [Source:MGI Symbol;Acc:MGI:3650257]
predicted gene 13178 Gene [Source:MGI Symbol;Acc:MGI:3650721]
predicted gene 436 Gene [Source:MGI Symbol;Acc:MGI:2685282]
predicted gene 438 Gene [Source:MGI Symbol;Acc:MGI:2685284]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa41857 Nonsense Mutation detected in F1 DNA Not yet available
sa15057 Essential Splice Site Available for shipment Available now
sa13637 Nonsense Available for shipment Available now
sa14153 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41857
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065851 Nonsense 102 420 2 4
Genomic Location (Zv9):
Chromosome 11 (position 29495215)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 28371201
GRCz11 11 28618375
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATAATGACCTGCAAAAGGTCAGTACCCCACGGGCTCCGTATTAAGGACT[T/A]GACCTTCAGTACAGTTCCAGTGAGGGTGTATGAGCCTACAGCTGCCTCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15057
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065851 Essential Splice Site 139 420 3 4
Genomic Location (Zv9):
Chromosome 11 (position 29495398)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 28371384
GRCz11 11 28618558
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
KTGAACCACTTTTCCATTGAWAYTTAACACRTCTNNNTTGTCTCTTCCTCCGY[A/T]GATGATTACGATGAAGTGTGTCAGCAWATRTCACTGAAGAGTRAYACSAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13637
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065851 Nonsense 372 420 4 4
ENSDART00000065851 Nonsense 372 420 4 4
Genomic Location (Zv9):
Chromosome 11 (position 29496189)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 28372175
GRCz11 11 28619349
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGACCTGTGAGTTTGATGTGCTKAGAGATGAYGGCTTTCTGTRCCAGAAG[C/T]GACTGAGGGATTTAGGAGTGGACGTCACATGGGARCACCTACCTGAGGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14153
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065851 Nonsense 372 420 4 4
ENSDART00000065851 Nonsense 372 420 4 4
Genomic Location (Zv9):
Chromosome 11 (position 29496189)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 28372175
GRCz11 11 28619349
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGACCTGTGAGTTTGATGTGCTKAGAGATGAYGGCTTTCTGTRCCAGAAG[C/T]GACTGAGGGATTTAGGAGTGGACGTCACATGGGARCACCTACCTGAGGGC
Associated Phenotype:
Not determined