Busch Lab

ZMP

si:ch211-147j13.3

Ensembl ID:
ENSDARG00000044694
ZFIN ID:
ZDB-GENE-091204-85
Human Orthologue:
FYB
Human Description:
FYN binding protein [Source:HGNC Symbol;Acc:4036]
Mouse Orthologue:
Fyb
Mouse Description:
FYN binding protein Gene [Source:MGI Symbol;Acc:MGI:1346327]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa23904 Nonsense Available for shipment Available now
sa15816 Essential Splice Site Available for shipment Available now
sa37279 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa23904
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065674 Nonsense 426 747 6 18
ENSDART00000147010 None None 264 None 11

The following transcripts of ENSDARG00000044694 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 18686334)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 19821823
GRCz11 21 19858459
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCTCAGGTCATCAGCAGCAGAGCCAAGTCAACCTCAAAAGAAACCGGAA[A/T]AAGATGTTAAAAACCAAAAAGACCGTGAGAAGAAAGAGAAAGACGCAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15816
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065674 Essential Splice Site 447 747 7 18
ENSDART00000147010 None None 264 None 11

The following transcripts of ENSDARG00000044694 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 18686482)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 19821971
GRCz11 21 19858607
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TACTTCACTAGYGATTTTAAACTGTTATCTTGCTAATGTGTTCTTTTCTC[A/T]GATAACACCRCCATTTCAGGTTATGCWTCAGGTAAAAGCAAAGTCTGACT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4944
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065674 Nonsense 722 747 16 18
ENSDART00000147010 Nonsense 239 264 9 11

The following transcripts of ENSDARG00000044694 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 18693222)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 19828711
GRCz11 21 19865347
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAACAAACACTGSTAATGATGACATTATAACATTTGCTTTCAGTCGGATA[C/A]GTCTCACTTAGCAACATCCAAACAGAGTAAGTCATGTTTTCTCAAGCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37279
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065674 Nonsense 744 747 18 18
ENSDART00000147010 Nonsense 261 264 11 11

The following transcripts of ENSDARG00000044694 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 18693488)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 19828977
GRCz11 21 19865613
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGACAGGTAACCAGTTCTTCTTTAAAATCTCCTTTACAGACTGTATTTA[T/G]GACAACGACTGAAGCTCTGCCACCGTCTTCTTCTCATCTTCAGGTGCAGC
Associated Phenotype:
Not determined