Busch Lab

ZMP

dusp4

Ensembl ID:
ENSDARG00000044688
ZFIN ID:
ZDB-GENE-040426-709
Description:
dual specificity phosphatase 4 [Source:RefSeq peptide;Acc:NP_957465]
Human Orthologue:
DUSP4
Human Description:
dual specificity phosphatase 4 [Source:HGNC Symbol;Acc:3070]
Mouse Orthologue:
Dusp4
Mouse Description:
dual specificity phosphatase 4 Gene [Source:MGI Symbol;Acc:MGI:2442191]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa39326 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7956
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065664 Nonsense 8 367 1 4
Genomic Location (Zv9):
Chromosome 21 (position 18948223)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 20083712
GRCz11 21 20120348
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTGACCAGTCCCCGTCGGAGGAGGAAAATGGTCACAATGGACGAACTTTG[C/A]GAAATGGACTGCAGCGTTTTGAAGAGGCTGATGAAGGACGACGGAGCGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39326
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065664 Nonsense 59 367 1 4
Genomic Location (Zv9):
Chromosome 21 (position 18948072)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 20083561
GRCz11 21 20120197
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCGCGGTGCCGTTAATATTCGCTGTAACACGATCGTTCGGAGGCGAGCG[A/T]AAGGCTCCGTGAGTTTGGACCAGATTTTGTCTGGGGACGATGAAGCGAGA
Associated Phenotype:
Not determined