Busch Lab

ZMP

st14b

Ensembl ID:
ENSDARG00000044655
ZFIN ID:
ZDB-GENE-061103-613
Description:
suppression of tumorigenicity 14 (colon carcinoma) b [Source:RefSeq peptide;Acc:NP_001071205]
Human Orthologue:
ST14
Human Description:
suppression of tumorigenicity 14 (colon carcinoma) [Source:HGNC Symbol;Acc:11344]
Mouse Orthologue:
St14
Mouse Description:
suppression of tumorigenicity 14 (colon carcinoma) Gene [Source:MGI Symbol;Acc:MGI:1338881]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa43648 Nonsense Mutation detected in F1 DNA Not yet available
sa32350 Essential Splice Site Available for shipment Available now
sa23942 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa43648
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087910 Nonsense 162 753 5 17
ENSDART00000101153 Nonsense 144 848 5 19
ENSDART00000147860 Nonsense 162 864 5 19
Genomic Location (Zv9):
Chromosome 21 (position 24568924)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 25254598
GRCz11 21 25291203
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCTTCTTCTTTTGTAGTGAAGGCAATAATAATGGTATTATTGCATATTA[C/A]TTGTCTGAGTTTAATGTGCGGGAATCCAAAGTATCTGCTTTGGAAGAGGC
Long Flanking Sequence:
TTAATAATTGCAATAATGGCTGAATTAGTCTGCTAAGTATGGCACAAACCTCCATTAATTGCTCAAAAAATCTATTATCAAGAGGTTTGGGATGTGATTTGTCAAATTACTCTTGCATAAAAACCTTACAATTGTCTTGAAAATTGAAATACAATTAGTTGAGGTGTGGTATTTGTAGTCTTTTATTGTAAAGTAAAAGCGCGCCCAACCTGCTGTTAGTAATTTTAATATAATATTCCAGCAGCCCGCTGTCACTTATGTCAGGACTAACTGATGAAAGTAAATAGTATAAAGCTTATATTTTCATAGGAATGTCTTAAGATTCGATTACCAGTACATGAGGATAACTAAACATTCTGGAAACAAAACCTTCAGTGTTTTACAACATCACAAATTATAATGACTCATTTAATTCGATGAATTGAATTTTTGTTTACCGAGTTTCTGTTTTTCTTCTTCTTTTGTAGTGAAGGCAATAATAATGGTATTATTGCATATTA[C/A]TTGTCTGAGTTTAATGTGCGGGAATCCAAAGTATCTGCTTTGGAAGAGGCTATTGCATCCATGGATGACACAGAAAATACCAGGAAAAGCCGAAGAGGGTTCAGTCGCATGACTGACAGCCTCATCATTGATGGCATTACTTCAGGAGGTAAATCTACTACCAAACAGTTTCATGTTACTTGTTTAGGCCTGTCACTTCTTTTAATCCAGCCAGGAACTTCTTAGGGACAAGAAACAAACAATGAACAAAGGAATAGGGGAATCGTTTTAATCAGTGTTGACTTGTATAAACTTAATTGATTTAATTATCAACATCTATAAGAGCAAAGACAATAAGAGACTTGTTTCAAATTTGTATTTTTCCATCCAATCCACCAAGGAACACCTAACAAATGGCATCACACTAAAATGAAAGGTAGAATCCAACCTAGTTATCTCAGAGGAAGATTGGTTGAGTATGTGCTCTGTACAGCCCAACTTCTTCCAGCTCTGGTACTGTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29595
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087910 Nonsense 216 753 6 17
ENSDART00000101153 Nonsense 198 848 6 19
ENSDART00000147860 Nonsense 216 864 6 19
Genomic Location (Zv9):
Chromosome 21 (position 24567735)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 25253409
GRCz11 21 25290014
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGTATAAAAAGTGTTGATTAATATTTTCTGTATTACAGCTGTGGATGCT[C/T]GATTAGCTGACCGAAACCTCAAACGTGAGCATAACAAGCATTATTTACTT
Long Flanking Sequence:
AAAATATTTTGGTGACGGATTGGACTTTTTTTTTACAGCAATTTAACTGGGAAATTTTGCAGTGAACTTAATGGTAATAGACTAGTATTTACTTAAAATATTTCTAACAACCAGTAAAAAAAACTGTAACTCGAAAGTGGCCACAACTCTCAAACCCCCTACAAAATCTAAATGGTTGGATATTGTATATAATGTTTGAAATATGGAGATGATGGCTTTTTCTTTAAAACTACAAATGGACAAATACATGCGATATTGGGCGAAATTGATTGTAATTATGCCTTTACACAGTTTAAACTGATTTTTATATGTATTTGTAAATGTGACCTGTAAGGAAATACAGGATGTGATCAGTCAACTGTTCATTTAAGGTACAATGTGTTATTGTAATTTAAAAATATATATATTTCTACTTATTTCTTTTCCTTTTTCTTCCTTAAAAAAGAAATAAAGTATAAAAAGTGTTGATTAATATTTTCTGTATTACAGCTGTGGATGCT[C/T]GATTAGCTGACCGAAACCTCAAACGTGAGCATAACAAGCATTATTTACTTAATTATTTGCATCTGTTTCTCAGACTCATATTGAGATTTTCTTGACTTTTTAGGGTCCAGTAAGAGGTCGAATCATGCTCATGCAAACCAGACAGACATAATCCGGTCTCCTGGTTTCCCCGATAACTCTTATTCTCCCAACCTTTACACTGAATGGCAGATACGGGCTGACCCAGAGCACAGGGTCAGACTGGAGTTTGACGTCCTGGACCTGGAGAAGGATTGTCATAATGACTTCATCAAAGTGTACGACTCATTAGCACCATCAGAGAAGCTAGTCATAACTGAGTGAGTGTTCATAATCTCTCTGTCATCTTCTCTGGGATGCAATGCAGCATCACACGTGTGAGCAATGTCATGTCACACATGTCTGTTTTCATTGTATTTGGAATATGTGGAATCTGATAAATGTGTTTATGTAGGAAATGTGGATACCGCTTACCCAACGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32350
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087910 Essential Splice Site 422 753 11 17
ENSDART00000101153 Essential Splice Site 517 848 13 19
ENSDART00000147860 Essential Splice Site 533 864 13 19
Genomic Location (Zv9):
Chromosome 21 (position 24562481)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 25248155
GRCz11 21 25284760
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGTGATGGGGTGAATGACTGTGGAGATAACACTGATGAGGAAAACTGTG[G/A]TAGGGATAAAAGGAGCTCTCAAATCAGGAAATACAGCGCAAGTGTAATGG
Long Flanking Sequence:
CAGTCAAATCAAACCAATTAACAGTAAAATTCAATTCTGACCGTTCCTATGTGAGTGAAGGATTTTCTGCAGAGTTTGAGGCCTTTGAACCCACCAATCGTGAGTAGAATCATGTTTTTTTTAAAGGGGTTGTTTATGTTCTAAGCCAGTCCACATGCTAAAAAATTACTCTGTCACCTTTCCACAGCCTGTCCTGGAAGATTTGAGTGTGACAATGATCTGTGTATTTCATCTGACCAGCATTGTGATGGGTACAATGACTGTGGTGATATGAGTGATGAGAGAGGCTGCAGTAAGTTTATATCATCATTTCTTGAACACATGGACGTTTTAGTTAAGGTACTGAGCATATTAATGATGTTGCTTTTTTTTTTCTTTACCCATGCATCCAGTGTGTAATGAGACTCAAATCCAATGCAAGAATGGCTTCTGTAAGCCCAGCTTCTGGGGCTGTGATGGGGTGAATGACTGTGGAGATAACACTGATGAGGAAAACTGTG[G/A]TAGGGATAAAAGGAGCTCTCAAATCAGGAAATACAGCGCAAGTGTAATGGAGACAGCTTCAGGTTGTTCATTCGATCTTTTCTGCAGGGAATTGCAAAACTTGGGAGTTCAGGTGTCGAAGTGGCCGCTGCATCTCAGCACAGAAGCAGTGCAATGGCTACAACGACTGTGGCGATGGTTCTGATGAATCTCGGTGTGCGAAATGTAAGGAAAAAAATTATTGAATCAAAGGTATTTTGCTGTTAGCTGCATTACCTGGGGCCTCATGTACAAAGACTTGCGTTGAATCTATACTAAAACATTGCGTTTGTGCAAAGCTGTAAATGTGCGTACGCAGTAAAAAATTCAGATGTATAAAACACTGTTTAAGCGGAATCACATGCATATTCTCTTTGTACATCTGAATTAATGTGAAACTGAGCGCACGTGCACGAATGCAAAACCCCTCCCTGCCTCCTCCCCCTAATAAATATGGTAATGACTCTACTTTAACAGAACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23942
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087910 Nonsense 603 753 15 17
ENSDART00000101153 Nonsense 698 848 17 19
ENSDART00000147860 Nonsense 714 864 17 19
Genomic Location (Zv9):
Chromosome 21 (position 24557418)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 25243092
GRCz11 21 25279697
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TACACAAAGAAGTGTGTTGCGCATCATTCCTCACCCTCAGTATGATCACT[C/A]GAGCTACGACAATGACATCGCTCTAATGGAGCTGGACAGTCCTGTGACTC
Long Flanking Sequence:
GTCTCAGTATTCAGTATACATGAGATCTCATGAATTTCAAGAAACATGTATTTTTGGTCAACATTACAAAGTTAAGACTTCTGTATTTCTGATGTGGTTCATGATGTTTATGTTATTTTGTAGAATGTGGGAAGAAGCCTCACAAGTCCAGTCGTATTGTCGGTGGAAAAGACTCAGATGAGGGAGAATGGCCCTGGCAGGTCAGCCTCCACATGAAGACGCAAGGTCATGTGTGTGGTGCGTCTGTTATCAGTAACAGCTGGCTGGTCACTGCTGCTCACTGCGTGCAAGATAATGATCAATTCAGGTGAGTTCTAATCTGCTTTGGCTTTCTCCTTCCCTCCTGAGCTGATTCTGAATGGCTTTTTGTTTTTTTTTTGCTAGATATTCACAGGCTGACCAGTGGGAGGTCTATCTAGGCCTACACAACCAGGGCGAGACTAGTAAATCTACACAAAGAAGTGTGTTGCGCATCATTCCTCACCCTCAGTATGATCACT[C/A]GAGCTACGACAATGACATCGCTCTAATGGAGCTGGACAGTCCTGTGACTCTGAATCAGAACATCTGGCCCATCTGCTTACCTGATCCCACACATTACTTCCCAGCCGGAAAATCTGTATGGATCACTGGCTGGGGCAAGTTAAGAGAGGGAAGCGGTAAGTTGTGTAACATAAACCTTCATTACCATTTCAGTTTGAAGTTGATAAGGTTCTTTTATGTATTTGGAAGAAGTTTGACTTATTTGATACAGCATAAGTAGCCATTCAGAGTTTTTATTATTCATTTTTAATGAGATTTTTTATGTATTTTTATTTACTGATATGGTACTCATTAGCTACTGACAATATCGATAAGCTGAGACGTTCCTTTTCTAATTCAGTTTATTCTGCATTGTCAGTAGCTTATGCTATGGGTGTCATATAAAATTGCCATTTTGAAACAAACACATTAAAATGCCATGTTGCAACAACCACAAGGCTAATAAGTGAAGGAAAAATTTC
Associated Phenotype:
Not determined