Busch Lab

ZMP

alg8

Ensembl ID:
ENSDARG00000044627
ZFIN ID:
ZDB-GENE-030131-5812
Description:
probable dolichyl pyrophosphate Glc1Man9GlcNAc2 alpha-1,3-glucosyltransferase [Source:RefSeq peptid
Human Orthologue:
ALG8
Human Description:
asparagine-linked glycosylation 8, alpha-1,3-glucosyltransferase homolog (S. cerevisiae) [Source:HGN
Mouse Orthologue:
Alg8
Mouse Description:
asparagine-linked glycosylation 8 homolog (yeast, alpha-1,3-glucosyltransferase) Gene [Source:MGI Sy

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa13303 Splice Site, Nonsense Available for shipment Available now
sa15959 Nonsense Available for shipment Available now
sa29590 Nonsense Mutation detected in F1 DNA Not yet available
sa14637 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13303
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065565 Splice Site, Nonsense 30 524 2 13
Genomic Location (Zv9):
Chromosome 21 (position 22008162)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 22856575
GRCz11 21 22893180
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AANNNNNTTTTGTATAAAATTGTCATTTTTAAAACTTTTTTGTATTTCAG[T/G]CACTCTACGGATTTTGAAGTGCATAGGAACTGGCKCGCCCTGACTCACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15959
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065565 Nonsense 73 524 3 13
Genomic Location (Zv9):
Chromosome 21 (position 22009190)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 22857603
GRCz11 21 22894208
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGGCTACATCTGAGTGGACGKTGGATTATCCTCCTCTGTTTGCYTGGTTT[G/T]AATATGGACTTTCTCATATTGCCCGATTTTTTGATAAGGAGATGCTGGTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29589
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065565 Essential Splice Site 222 524 6 13
Genomic Location (Zv9):
Chromosome 21 (position 22010261)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 22858674
GRCz11 21 22895279
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TACGGTATCTTTCTGCTAAGATGTTTTTGTTTCACCCAGAGCAATCCAGG[T/A]AATTTATTTTATGCTTTTTCTCCATAATTAATAAAAGTAAATTAATAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29590
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065565 Nonsense 389 524 10 13
Genomic Location (Zv9):
Chromosome 21 (position 22015504)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 22863917
GRCz11 21 22900522
KASP Assay ID:
2261-5611.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTTGGTTGGCATGTACATGAAAAAGCCATTTTGATGGTCATACTGCCCT[T/G]AAGGTGATTTAATTTTGTTTTGTCTGATGGTATTCTTACATTAGCATGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14637
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065565 Nonsense 460 524 13 13
Genomic Location (Zv9):
Chromosome 21 (position 22015987)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 22864400
GRCz11 21 22901005
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAATAATTCAGGAAAGGCGGTAGTTTGTTGAATCCACTGGAGTCAATKTA[T/A]CTCTTGGGCCTGATTCCTCTTGAGCTTGTCTGTGAGTTTATTTACCCGCY
Associated Phenotype:
Not determined