Busch Lab

ZMP

pcf11

Ensembl ID:
ENSDARG00000044625
ZFIN ID:
ZDB-GENE-041114-175
Description:
cleavage and polyadenylation factor subunit, homolog [Source:RefSeq peptide;Acc:NP_001007308]
Human Orthologue:
PCF11
Human Description:
PCF11, cleavage and polyadenylation factor subunit, homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:
Mouse Orthologue:
Pcf11
Mouse Description:
cleavage and polyadenylation factor subunit homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa23932 Essential Splice Site Available for shipment Available now
sa37303 Nonsense Mutation detected in F1 DNA Not yet available
sa23933 Nonsense Available for shipment Available now
sa43640 Nonsense Mutation detected in F1 DNA Not yet available
sa43641 Nonsense Mutation detected in F1 DNA Not yet available
sa43642 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa23932
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065562 Essential Splice Site 544 1457 5 16
Genomic Location (Zv9):
Chromosome 21 (position 21997956)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 22846369
GRCz11 21 22882974
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATCTAAAAGATGGCAAGAGGTGGAGGAGTGGATGGGAAGAAAACAAACA[G/A]TATGTCATTTCAATTACTTGCACCTTTTGTCTTAATTATATTCAATTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37303
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065562 Nonsense 556 1457 6 16
Genomic Location (Zv9):
Chromosome 21 (position 21998072)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 22846485
GRCz11 21 22883090
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCAACTTTGTTTTAGTCCTAAACACTCAGATACAGATCTGTCACATGGG[C/T]GAATGGGGATCCAGAAACACAAAACTTGGAACACTAATCAAAGACCACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23933
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065562 Nonsense 704 1457 8 16
Genomic Location (Zv9):
Chromosome 21 (position 21998789)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 22847202
GRCz11 21 22883807
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TACCTTTGCATGAAATGTATCACTATCCGCCTCATCATGAAGTATCTGAA[C/T]AATATAGTGAAAGCTTGGATGTGCATAAAATGTCAGGTGATCCCATAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43640
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065562 Nonsense 998 1457 8 16
Genomic Location (Zv9):
Chromosome 21 (position 21999671)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 22848084
GRCz11 21 22884689
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGGATATGAGGAACCACATTTTCCAGCTAGGATAATTAATTATGATGAA[C/T]AGCAGGGTCCAGTTAGATTTGATAACCCAACATGTGGGATTCGTTTTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43641
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065562 Nonsense 1022 1457 8 16
Genomic Location (Zv9):
Chromosome 21 (position 21999744)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 22848157
GRCz11 21 22884762
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAACCCAACATGTGGGATTCGTTTTGAGAACCCTGTGCAGCCTGAACCCT[T/G]AAGGTTCGATGCACCACCTGTCATGCCAAGATATGACCCACAGGGCCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43642
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065562 Nonsense 1091 1457 8 16
Genomic Location (Zv9):
Chromosome 21 (position 21999950)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 22848363
GRCz11 21 22884968
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACCCAATTTCAACATGCCACCCATAAACTCATTTGGTGGTCCAGCCCAG[C/T]AGTTTTCCATGCAGCAAAATGTCTCGCAAACCTCCAACTTCAGTGTGCCA
Associated Phenotype:
Not determined