Busch Lab

ZMP

hif1al2

Ensembl ID:
ENSDARG00000044550
ZFIN ID:
ZDB-GENE-050211-2
Description:
hypoxia-inducible factor 1, alpha subunit, like 2 [Source:RefSeq peptide;Acc:NP_001012371]
Human Orthologues:
EPAS1, HIF1A, HIF3A
Human Descriptions:
endothelial PAS domain protein 1 [Source:HGNC Symbol;Acc:3374]
hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor) [Source:HGNC
hypoxia inducible factor 3, alpha subunit [Source:HGNC Symbol;Acc:15825]
Mouse Orthologues:
Epas1, Hif1a, Hif3a
Mouse Descriptions:
endothelial PAS domain protein 1 Gene [Source:MGI Symbol;Acc:MGI:109169]
hypoxia inducible factor 1, alpha subunit Gene [Source:MGI Symbol;Acc:MGI:106918]
hypoxia inducible factor 3, alpha subunit Gene [Source:MGI Symbol;Acc:MGI:1859778]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa23956 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa893
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065407 Nonsense 285 660 7 14
ENSDART00000130632 Nonsense 288 663 7 14
Genomic Location (Zv9):
Chromosome 21 (position 26728040)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 27296951
GRCz11 21 27333646
KASP Assay ID:
554-0800.1 (used for ordering genotyping assays)
KASP Sequence:
ATCTGTTGGGTCAATCTGTATACCAGTACTATCATCCATCTGACTGCCAG[C/T]AAATCCGCAAGGCACACATTTGCTGTAAGAGAGATATCTTGTTATCTGTT
Long Flanking Sequence:
GAACCACAAAAATGTGAAGTGTTCCTCAGGATAAAAAAGGCAATGAACACGAAACTGACTGGTTGGAAAGTAAGAATGGCATCTTTTAATTGTTTGAAAAATAACACAATTTTCATTGTTTCACGTTTTGCTTTCACTGTATCAAGATTATTCAGTGTTCTGGAAAGAAAAGGTCATCTGCTACACCTGGATCCAGTTGTCTGGTTCTTGAGTGCAGGGTTCTGCCCATTCAGGAGATCACAGAAGTGGATGAAGCATTGAATGCATGTACATTTATGAGCGTTCACAGCCCTGACATGACGTTCACCTACTGCCACTCAAGGTACAGCCCTGTACTTGCTGCTTTCATGTGCAAACAGCTAAATGCTTTGACTCTCTTTGGGCTGTTTTTACATTTGAAACTCTATTTTTGGCTTAGGGTCGTGAAATTGATCGGCTTTCGAGACACAGATCTGTTGGGTCAATCTGTATACCAGTACTATCATCCATCTGACTGCCAG[C/T]AAATCCGCAAGGCACACATTTGCTGTAAGAGAGATATCTTGTTATCTGTTTACCACTTTGTGTGCTGAATTTGATCGTTTTGTTAAGCCTTATGTGATAACTTACTCTCATTTCATTCAAAACTCTCAAACTAATGATGGATTTACATATTTTTACTATACATTTTATTTATTTGTACATTTTTATTTAAGTTTAAAACTATATAAGGATATATACATATTACATATTAATATTTTATCTATATCACAAACTGTCTCTAATATTCAAATATCTGCTTGAAACAGTGCTCTCCAAGGGTCAAGTGTCGACCGGGAAATACCGGCTGCTGCACAGATATGGAGGTTATGTGTGGGCAGAAACAGACGCCTCACTGGTGTGCAACAGTCAGACTGGTGTGCCAGAGAGTGTCGTCTGCATCAATTACATTCTAAGGTTAGAAAATTTTCACTAGCAGATATCTTGAATGTCTACAAGTATACCATGAATGTTTTGTGGGTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23956
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065407 Nonsense 578 660 14 14
ENSDART00000130632 Nonsense 581 663 14 14
Genomic Location (Zv9):
Chromosome 21 (position 26722524)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 27291435
GRCz11 21 27328130
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTTATATACGTGTGTGCTGCATTTCCACTAGATGGATCAACACCACCAT[G/A]GATATGTGACGGACACTTGAATCATCTTGAACCGAAGTTCAGATCACTTC
Long Flanking Sequence:
CTAATGAGCTGATGATCTGACTCAGGTGTGTTTGGTTAAGGAGACATGGAAAACATGCAGAGCTGGTGATCCTCCAGACATGTGGTTGAGAAACAAAGATCTAAACCATCTTTTTTTCAATATAAATGACCTTTTGTGCGATGAAAAGATTCCAAAATTTTTAAAGGGGTAATTCAGCCACAAATGAATTCTCTGCTATCATTTACATTAATATCTTCCACCTGACCTAAACCTGTTTGAGTTTCTTTCTTTGGTTAAACACAAAATGAGACAACCAGTAGCCATTGACTTACATTGTATAGATGTCAATGGCTACATTTTCCAGCATTCTTCAAATCTCATAAAGGTTTGGAAACACTTAGGAATAGTGAGTAAAAGGTCATTATTGTGAGAACTATCCATTTAAAGTTTCTTGATGGAACCATCGATGTCAATAAAGAACACGTGAACATTTATATACGTGTGTGCTGCATTTCCACTAGATGGATCAACACCACCAT[G/A]GATATGTGACGGACACTTGAATCATCTTGAACCGAAGTTCAGATCACTTCCAGAGAAAACCAATTGTCCTCCTCAAAAGAGAAGACACCAACATGAAGTAAAAACAGCCGCGGCACTTTTGACTCTGCCTGTGTTGAGCGGATGGGAGTGTGAAGTCAACGCTCCTCTCGAACACACATCATATTTACTCCAAGGGACAGAGATTATGGCCGTTCTGGACCAAGTAGCCTCCAGAGTGCCTTGGTGCTGATGATTCAAAACAAAAGACTTAATGTTTATGCTTGGTCAGCAATGCGCTTTTATTATATCAATGCCTGTGCGATAGGAGTAATGGACTATAGTGTTTTTCAGTCAACGATGAACGTCCGGTGAAAGTCTATTCTGGTGTGACTATTTTCAAATTCATAAGGTTCCTTTTACAGCCTTGATGTTGTAATGTAGTTAAAATAATTTGTATGGGATGACAATTAACCAGAAGCCCTGGGGCTGGCTGACTGAAA
Associated Phenotype:
Not determined