Busch Lab

ZMP

nr4a2b

Ensembl ID:
ENSDARG00000044532
ZFIN IDs:
ZDB-GENE-040718-103, ZDB-GENE-990415-184
Description:
nuclear receptor subfamily 4, group A, member 2b [Source:RefSeq peptide;Acc:NP_001002406]
Human Orthologue:
NR4A2
Human Description:
nuclear receptor subfamily 4, group A, member 2 [Source:HGNC Symbol;Acc:7981]
Mouse Orthologue:
Nr4a2
Mouse Description:
nuclear receptor subfamily 4, group A, member 2 Gene [Source:MGI Symbol;Acc:MGI:1352456]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa40651 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3600
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065385 Nonsense 255 586 3 8
ENSDART00000065385 Nonsense 255 586 3 8
Genomic Location (Zv9):
Chromosome 6 (position 12375549)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 12228771
GRCz11 6 12463629
KASP Assay ID:
2259-7275.1 (used for ordering genotyping assays)
KASP Sequence:
TACTGGAAAGCCCGGTGGCATCACCGCAGGCTAGAGGATCTCCGTCCAGC[G/T]AGGGTTTGTGCGCTGTGTGCGGGGACAACGCAGCCTGTCAGCACTACGGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa18834
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065385 Nonsense 255 586 3 8
ENSDART00000065385 Nonsense 255 586 3 8
Genomic Location (Zv9):
Chromosome 6 (position 12375549)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 12228771
GRCz11 6 12463629
KASP Assay ID:
2259-7275.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TACTGGAAAGCCCGGTGGCATCACCGCAGGCTAGAGGATCTCCGTCCAGC[G/T]AGGGTTTGTGCGCTGTGTGCGGGGACAACGCAGCCTGTCAGCACTACGGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26699
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065385 Nonsense 311 586 4 8
Genomic Location (Zv9):
Chromosome 6 (position 12376367)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 12229589
GRCz11 6 12464447
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCTGGCGAACAAAAACTGTCCTGTGGACAAAAGACGGCGAAATCGATGC[C/T]AATATTGCCGTTTTCAAAAGTGCCTGGTCGTTGGGATGGTAAAGGAAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40651
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065385 Essential Splice Site 449 586 7 8
Genomic Location (Zv9):
Chromosome 6 (position 12377100)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 12230322
GRCz11 6 12465180
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATCTACATTTTTAAAAGACATAATATAATAACTTTTCAATTTTCTCACC[A/T]GATCTAACCTGCCAGAGGACAAACTCATCTTTTGCAACGGAATGGTTTTA
Associated Phenotype:
Not determined