Busch Lab

ZMP

slc15a1b

Ensembl ID:
ENSDARG00000044528
ZFIN ID:
ZDB-GENE-030131-4661
Description:
solute carrier family 15 (oligopeptide transporter), member 1b [Source:RefSeq peptide;Acc:NP_932330
Human Orthologue:
SLC15A1
Human Description:
solute carrier family 15 (oligopeptide transporter), member 1 [Source:HGNC Symbol;Acc:10920]
Mouse Orthologue:
Slc15a1
Mouse Description:
solute carrier family 15 (oligopeptide transporter), member 1 Gene [Source:MGI Symbol;Acc:MGI:186137

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa33827 Essential Splice Site Available for shipment Available now
sa20664 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5355
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047896 Nonsense 19 718 3 23
Genomic Location (Zv9):
Chromosome 6 (position 12497257)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 12350479
GRCz11 6 12585337
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATTAATTATATGTTTCATTTTGCTTTATTATAGGCAAGTTGCTTTGGATA[T/A]CCTGTCAGTATATTTTTYATTGTGGTGAATGAGTTCTGTGAGCGATTCTC
Long Flanking Sequence:
ACCCAATCAGGTAAGGCAACTCAAACCGTTGGAGGAAACCGATTGCTACAAACCATTTGAATTAAAAAATGAAAACATGAGTACTGTGAACTTACTCCATTTAAGTTGAAGTGATGAGGTATATAATTAACTCATGACCTTTAACACTGAGTTTAAAACTCTTTTCAAATGAGTAGAATTAACTTTCTATAAATTTTGAGTTAACTACACTCATTTTTTTATTTGATAAAGTTGACTGCTGGGTTTTAAGGTGTAACTTATTTCATTTAGTACTGTTTTACTATAATAAATCCATAGATCATTTTTCTTATCAGTATGTTCTTGATTCAACAATATTTGTATTGTCAATTTATAAAAACATTATAAATTATTGTCATCACATAGTAAAACACACCTGGTTTTCCCTAGGACATGATATCAGAAAAATATTATTCAAAATAAAAGGTATTTATTAATTATATGTTTCATTTTGCTTTATTATAGGCAAGTTGCTTTGGATA[T/A]CCTGTCAGTATATTTTTTATTGTGGTGAATGAGTTCTGTGAGCGATTCTCCTACTATGGCATGAAAGGTAAGTCTAAACATTTTGACTTGTTCATACGCTGTAAAAAAAAATCCTGCTTGCCTTAAATGTTCAAGCTGAATCAAATTAACTTTAAAAGTCCATTGAACTTATATTATGTTAAACTGACTTTAAACAGTTTGCGTAACTAATAAAATTACGTTAGAACATGATTAACTTTTACCGTTTAATAAGTTACAGTGATCTAAAAACATTTGCTGCCAGAACTAATTGATCAACTAATTTTTTACAGTGTACTCTCACACTAATCTCTTATTAGTTCTTCTATTTCTTTCTATTCTCATTCTTCTTGTGTTTTTGTTCTGTTTGTGTCGTGCAGCGGTGCTGGTCCTGTACTTCAAGTATTTCATTGGTTGGGATGATGACCTGTCCACCACCATCTACCACACGTTTGTGGCTCTCTGCTACCTTACACCCATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33827
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047896 Essential Splice Site 220 718 8 23
Genomic Location (Zv9):
Chromosome 6 (position 12490309)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 12343531
GRCz11 6 12578389
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTATCCTCTGGCGTTTGGCGTTCCTGCAGCGCTCATGGTGGTTGCCCTCA[G/A]TAAGTTACAGCAGTTTGCTTTTATTTTGATGTGTGCAATGCTCCTTCTGA
Long Flanking Sequence:
ATTGTAATTAAAAAACACAATATTACTGCTTGAATTGCATTTTAATCGCATGTCTAATTGTGTCAAATGACATTTTATAACCTAAAAAACCTAATTATTATTGTAAAAACAAATAATCACAATATTTCTGTTTTACTTGCATTTTTTATTCATTTTTAAATAGAAAATAAAAACAAAAACATCATATTTGGTGTGACATTAACAATAAATGTAATTCTATTCCAGGAAAAACAAAGAAGCACTTTCTTTTCCATCTTCTATCTGTCCATCAATGCTGGCAGTCTGCTCTCCACTCTCATCACACCCATCCTGAGATGTAAGAACTGCTCCAATCACCACATCACCGTTGAGATTATAACTAAACACTCTTTTGAACAATCTACCTTGTGTTTGTTTGTGTTCATTACGATCTTCAGCCCAGGAATGTGGCATCTACGCAAAGCAGAGCTGTTATCCTCTGGCGTTTGGCGTTCCTGCAGCGCTCATGGTGGTTGCCCTCA[G/A]TAAGTTACAGCAGTTTGCTTTTATTTTGATGTGTGCAATGCTCCTTCTGACCACTCGATGGCAGTCTCGATGATGCTGAGCTTTGCTTTGTTTTCTGTCTGCAGTTGTGTTCGTCATAGGACACAAAATGTATATCATGGAGTCTCCAAAGGGCAACATCCTGCTGCAAGTCATTAACTGCATTGGAGTAAGTAACTAACAACATCACATATTACTTGGAGATACAATTATACAGTGTACATTGCATTTTGCTTTAATAGATCCTACATTTACATTTACTTTTGTCCAAAAAGTGACTTATAATTGATGAAGATGAAAATGAAAAGGCAATACACACAAGAAGAGCTAACTATACAAAGGAACCATTAGTGCTCAGAGCATTAAATACTAGTATGGGGTTCCATTTGTGCCAAAATTTCCATGCCTGCATTCTGCTTTGTAATTTACATTTGTCTTTGTCTACTCTCATTGCCCGCATGTTTAGGAAATTCAGCATTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20664
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047896 Essential Splice Site 249 718 10 23
Genomic Location (Zv9):
Chromosome 6 (position 12487066)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 12340288
GRCz11 6 12575146
KASP Assay ID:
2259-7278.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACGCCTCATCCAATTTTTATTAAATGACTGTTGTTGTTTTCTCTTCTGCA[G/A]TTTGCGCTTAATAACCGTTTCAGACATCGCGGTAAACAGTACCCAAAAAG
Long Flanking Sequence:
TATGGAAAATATTTTCTAAAGTAGTAAATGGCTTATGATGGTGTCCTTAACTCTTTTCGTGTGTTGTTTGCTCAAAAAAGAGATCTTTGCTGCCACTTATTTAAAATGAGCTGAAACAACACAATTCCTGATAATGTTTTGGGACAACTTAATTATTTTGTGTTCAGTCCACTTAAAATGGTTAAGTTAACTTAATCGATTTGTGTTGTGACAATATGAAGGATTTGTGTGACACCCTGCATTGGTTACACTGTCAAAAATACTGATTTCCATGCAATTGATTTGAAGGAATTAAGTTAACTTTAGGTGGATAATACATATAAAAAATTAAGTTGTCACAATAAATACCCCTCAGCGATTGTTTTGTTTCAGCTCACAAGTAGTTTGAACAAACAGGAAACAAAATTTTTTTTTCAATGCGCAGTGTATTCAGCATTGAGTAACATGGGGACGCCTCATCCAATTTTTATTAAATGACTGTTGTTGTTTTCTCTTCTGCA[G/A]TTTGCGCTTAATAACCGTTTCAGACATCGCGGTAAACAGTACCCAAAAAGAGAGCACTGGATGGACTGGGCAGAAGAGAAATATGATGTGAGTTACATGTAAATATAACCTGTGATATGCACTTCAGAATACAAGAAGGTGTTCGCAAACACACACTGGCATAATGTGAAACAATCTAAATGTCTGTCTGTTTGCAGAAACTGCTGATTGCACAGGTGAAGATGGTGGTGAAGGTGCTGTTCCTCTACATCCCGCTGCCAATGTTCTGGGCTTTATTTGACCAGCAGGTCAGTGTTCTACTTTAGTGATGCTTCAAATGCTATTCTCTATATGTGTTTCTACCAAACATTCAGGCCTGATGGTGAATGTAAGCTGTGTTGTTTTTTTTCAGGGCTCCCGTTGGACTATTCAAGCCACCACCATGGACGGTAACTTTGTACGTTCAGAAACTCTTTTACTAGCTTTGACATTTGCATATATTAGTAATAGTGCCATTTATG
Associated Phenotype:
Not determined