Busch Lab

ZMP

DEF6 (2 of 2)

Ensembl ID:
ENSDARG00000044524
Description:
differentially expressed in FDCP 6 homolog (mouse) [Source:HGNC Symbol;Acc:2760]
Human Orthologue:
DEF6
Human Description:
differentially expressed in FDCP 6 homolog (mouse) [Source:HGNC Symbol;Acc:2760]
Mouse Orthologue:
Def6
Mouse Description:
differentially expressed in FDCP 6 Gene [Source:MGI Symbol;Acc:MGI:1346328]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa39353 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa29683 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa39353
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065377 Essential Splice Site 79 615 2 11
Genomic Location (Zv9):
Chromosome 22 (position 960621)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 963533
GRCz11 22 980431
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTCCAGCCAGGGGTACATGCCCTACCTGAACCAGTTCATTCTGGACAAG[G/A]TGCAAAACAACACACACAAATACACACACACAAACACACACACTTTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29683
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065377 Nonsense 529 615 10 11
Genomic Location (Zv9):
Chromosome 22 (position 972634)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 975546
GRCz11 22 992444
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGATTTAGCAGCATATTCATGAGTTTATCCATCCGCAGGCTGCTCAGCGT[A/T]AACTCCGGCAGGCCAGTACGAGTGTTAAACACTGGAACGTCCAGATGAAC
Associated Phenotype:
Not determined