Busch Lab

ZMP

st6gal1

Ensembl ID:
ENSDARG00000044514
ZFIN ID:
ZDB-GENE-060322-3
Description:
beta-galactoside alpha-2,6-sialyltransferase 1 [Source:RefSeq peptide;Acc:NP_001003853]
Human Orthologue:
ST6GAL1
Human Description:
ST6 beta-galactosamide alpha-2,6-sialyltranferase 1 [Source:HGNC Symbol;Acc:10860]
Mouse Orthologue:
St6gal1
Mouse Description:
beta galactoside alpha 2,6 sialyltransferase 1 Gene [Source:MGI Symbol;Acc:MGI:108470]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa43676 Nonsense Mutation detected in F1 DNA Not yet available
sa12294 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa43676
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065366 Nonsense 318 484 6 8
ENSDART00000100911 Nonsense 318 404 6 9
ENSDART00000126205 Nonsense 329 495 6 8
ENSDART00000137728 None None 265 None 4
Genomic Location (Zv9):
Chromosome 21 (position 29942759)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 31143010
GRCz11 21 31179705
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTTGCATAGTTAATGGCATCTGAAGACCACCATTTCCTCTCCAGCTCTT[T/A]GTACAGTGCAGGGATTTTAGTGAGCTGGGATCCTAGCCCTTATTCTTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12294
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065366 Essential Splice Site 338 484 6 8
ENSDART00000100911 Essential Splice Site 338 404 6 9
ENSDART00000126205 Essential Splice Site 349 495 6 8
ENSDART00000137728 None None 265 None 4
Genomic Location (Zv9):
Chromosome 21 (position 29942821)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 31143072
GRCz11 21 31179767
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGATTTTAGTGAGCTGGGATCCTAGCCCTTATTCTTCAGATCTATGGGAG[G/A]TAAGAATGKGCTTTGTKTACTTTCTAGCATTCTTCAAACACAAAAAAAGG
Associated Phenotype:
Not determined