Busch Lab

ZMP

si:ch73-194h10.2

Ensembl ID:
ENSDARG00000044441
ZFIN ID:
ZDB-GENE-100921-21
Human Orthologue:
MYO7B
Human Description:
myosin VIIB [Source:HGNC Symbol;Acc:7607]
Mouse Orthologue:
Myo7b
Mouse Description:
myosin VIIB Gene [Source:MGI Symbol;Acc:MGI:107709]

Alleles

There are 9 alleles of this gene:

Allele Name Consequence Status Availability
sa40701 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa40702 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa40703 Splice Site, Nonsense Mutation detected in F1 DNA Not yet available
sa15693 Splice Site, Nonsense Available for shipment Available now
sa10082 Essential Splice Site Available for shipment Available now
sa20714 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa40701
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065268 Essential Splice Site 192 2179 5 49
ENSDART00000143218 None None 1419 None 30
Genomic Location (Zv9):
Chromosome 6 (position 27771339)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 28072550
GRCz11 6 28063111
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGCTCCTGGATTGAGCAGCAAGTTCTAGAGGCCAACCCTATCTTAGAAGG[T/C]ACAGTTACATACACTTACATCTTCCTTATATTTCCTCCAGTAAACATTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40702
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065268 Essential Splice Site 596 2179 15 49
ENSDART00000143218 None None 1419 None 30
Genomic Location (Zv9):
Chromosome 6 (position 27778813)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 28080024
GRCz11 6 28070585
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTGATTTAAATTACTTTGATTTGCATTCCCTTTTGTTTCTCACCCCATC[A/T]GCAAACAGCAGACACAAAGAAGCAAGTTCCAACATTAACTGGTCAGTTTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3593
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065268 Essential Splice Site 871 2179 21 49
ENSDART00000143218 None None 1419 None 30
Genomic Location (Zv9):
Chromosome 6 (position 27783884)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 28085095
GRCz11 6 28075656
KASP Assay ID:
2259-7608.1 (used for ordering genotyping assays)
KASP Sequence:
WAGAGCCACCATGTTTTGTTAAATATCTCAAGCTACATGYCCTCTTTTCA[T/G]CCATCCATGTCGTTTGCAGGCTTTCMTCTCACTCCAGGAGCGCAGGGCTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26754
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065268 Nonsense 1047 2179 24 49
ENSDART00000143218 None None 1419 None 30
Genomic Location (Zv9):
Chromosome 6 (position 27787362)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 28088573
GRCz11 6 28079134
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACCTTAAACAGATTCTAAAATCATTCAGCATGAAGTGAGTGAAGTAAGT[G/T]AAAATCCTCATTGGCTAGTGTATGAAATATTGTTGCTCATCATCAGCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40703
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065268 Nonsense 1754 2179 39 49
ENSDART00000143218 Splice Site None 1419 None 30
Genomic Location (Zv9):
Chromosome 6 (position 27804614)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 28105825
GRCz11 6 28096386
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAAGTTGGCGTGCACCTATTTTGAAGTATATGGGTGATTATCCCACCAGA[C/T]AGGTTCAGAGCCCTCTGGAGCTCACAGATCAGATCTTTGGCCCACCTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15693
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065268 Splice Site, Nonsense 1918 2179 42 49
ENSDART00000143218 Splice Site, Nonsense 1155 1419 22 30
Genomic Location (Zv9):
Chromosome 6 (position 27814656)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 28115867
GRCz11 6 28106428
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCATGYTGTCCACAGCTGAAGGTTTCAGCCTCTTCAWGAAAACTCCTGAY[A/T]AGGTTTGTTCCTARTSTACCATGATTTATATTTAACAGCCAGGACTGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10082
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065268 Essential Splice Site 1984 2179 44 49
ENSDART00000143218 Essential Splice Site 1221 1419 24 30
Genomic Location (Zv9):
Chromosome 6 (position 27815621)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 28116832
GRCz11 6 28107393
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TATCCCTGGGAGAGATGTGGAGGCAGATCTCATCTTCCATTACCCACAGG[T/A]ACTGAAATGTATGGTAAAATTCCCATGTAAGCTTTCYAAAAATATCTACA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26755
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065268 Nonsense 1986 2179 45 49
ENSDART00000143218 Nonsense 1223 1419 25 30
Genomic Location (Zv9):
Chromosome 6 (position 27817152)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 28118363
GRCz11 6 28108924
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTAATACTATTGTTACATTTTCCCCATTTTTTTCACATCATCTAGGAGT[T/A]GCCGAAATACTTGAGAGGTTATCATCGTTGTACCAAAGAAGAAATGGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20714
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065268 Nonsense 2068 2179 46 49
ENSDART00000143218 Nonsense 1305 1419 26 30
Genomic Location (Zv9):
Chromosome 6 (position 27817484)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 28118695
GRCz11 6 28109256
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTACAACAAGCAAACGGGCATGACTGTGGAAGAGGCAATGATCGGCTTTT[T/A]GAAGATTGTCTATAAATGGCCCACATTTGGATGTGCCTTTTTTGATGTCA
Associated Phenotype:
Not determined