Busch Lab

ZMP

zgc:153492

Ensembl ID:
ENSDARG00000044440
ZFIN ID:
ZDB-GENE-061110-55
Description:
hypothetical protein LOC777754 [Source:RefSeq peptide;Acc:NP_001071263]
Human Orthologue:
WDR48
Human Description:
WD repeat domain 48 [Source:HGNC Symbol;Acc:30914]
Mouse Orthologue:
Wdr48
Mouse Description:
WD repeat domain 48 Gene [Source:MGI Symbol;Acc:MGI:1914811]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa9279 Nonsense Mutation detected in F1 DNA Not yet available
sa6783 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa37968 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa44201 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5091
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105610 Nonsense 50 524 2 15
Genomic Location (Zv9):
Chromosome 24 (position 42634735)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 41192922
GRCz11 24 40892716
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCAATGCGCTACAGCTGGATCCAGCTCTTAACCGGCTCTTCACGGCCGGA[C/T]GAGACTCCATTATTAGGATATGGAGCGTCAACCAGCACAAGGTAACCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9279
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105610 Nonsense 118 524 5 15
Genomic Location (Zv9):
Chromosome 24 (position 42630998)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 41189185
GRCz11 24 40888979
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATCAGTTTTTTTATTTGCTGATAATACTATATATTTGTTTTTTAGGACTA[T/A]GTTAAAGCATTAGCGTATGCTAAAGACAAAGAGCTGGTGGCTTCAGCAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6783
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105610 Essential Splice Site 160 524 5 15
Genomic Location (Zv9):
Chromosome 24 (position 42630872)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 41189059
GRCz11 24 40888853
KASP Assay ID:
554-4291.1 (used for ordering genotyping assays)
KASP Sequence:
GATGTGAACACACTGACAGCGCTGACCGCATCCAACAACACCGTCACTAG[T/G]GAGTTTACAATACASTCTAAAACCTACTGAACTTTGAGTCAAATATRAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37968
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105610 Essential Splice Site 189 524 6 15
Genomic Location (Zv9):
Chromosome 24 (position 42627774)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 41185961
GRCz11 24 40885755
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGCCATGAATCAGATGGGGACGGTTATAGTTTCGGGATCCACTGAAAAG[G/A]TTTGAGGCATCACAATGCTTTTAATGTCCATGATATGACAGCAGCTTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44201
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105610 Nonsense 241 524 8 15
Genomic Location (Zv9):
Chromosome 24 (position 42625933)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 41184120
GRCz11 24 40883914
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCTGTCAGGCAGTTCAGACGGGACGATCCGGCTCTGGTCTTTGGGTCAG[C/T]AGCGGTGCATCGCCACGTATCGCGTCCATGATGAAGGTGTGTGGGCTCTG
Associated Phenotype:
Not determined