Busch Lab

ZMP

angptl3

Ensembl ID:
ENSDARG00000044365
ZFIN ID:
ZDB-GENE-010817-3
Description:
angiopoietin-related protein 3 [Source:RefSeq peptide;Acc:NP_571893]
Human Orthologue:
ANGPTL3
Human Description:
angiopoietin-like 3 [Source:HGNC Symbol;Acc:491]
Mouse Orthologue:
Angptl3
Mouse Description:
angiopoietin-like 3 Gene [Source:MGI Symbol;Acc:MGI:1353627]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa277
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065146 Nonsense 97 457 1 9
ENSDART00000104538 Nonsense 97 460 1 11
ENSDART00000108615 Nonsense 97 464 1 7
ENSDART00000140004 Nonsense 99 466 1 7
Genomic Location (Zv9):
Chromosome 6 (position 32040926)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 32361842
GRCz11 6 32348756
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACATCTTTGATCGTTCCTTCTACCAGCTCTCGGTGGTCACCAGCGAAATT[A/T]AAGAAGAGGAGGAGAAGCTGAAGGAGACCACAATATTTTTGAAGGCCAAT
Long Flanking Sequence:
AGATTAGGAGGAGGATGCTCAACACAGCTAGCTTAATAATTACCAAATGCTCCCTCCCCTCTCAGTGTAGCGGTATATATTTGAGGAATCTCTGCTGTTTTTGGCGTTCAAGTATGAGATGAGAAGCGAGAAAAGAGGCTTGAAAGAGACCCAGCAGGGAACAGACTGAAGCAGTGAGCAAATCTACTTTTAAACCAACAAAAAGGATGTTGATGTTGATCCTGCTTTTGTGGCTAAGCTTGTCCACAACAAGCGCAGCCCCTAACTCAAAGAAATCACCCACGGAGGCGCCAATACTTATAACCGCACCGCCGACTGAAGCTAGATCCCGCTTCGCCATGCTAGATGACGTGCGACTGCTGGCCAACGGTCTGCTTCAGCTCGGCCAGAGTCTCAGAGAGTTTGTGCACAAGACCAAGTCTCAGATCAACGACATCTTCCAGAAGCTCAACATCTTTGATCGTTCCTTCTACCAGCTCTCGGTGGTCACCAGCGAAATT[A/T]AAGAAGAGGAGGAGAAGCTGAAGGAGACCACAATATTTTTGAAGGCCAATAATGAGGAGATCAGAAACCTGTCATTGGAGATCAACTCAAAAATCAACAACATTCTCCAAGAGCGCAGCCAGTTGCACACTAAGGTCGGTGGGCTGGAGGAGAAGCTGAAGGGCTTGTCGCAGAGCATGATGCCTTTGGAGCAACTTCAAGAGATCACTGCTTTGAAGGTAAGTTTGGTAAAGAATTTAAAATCAAACTACAGCTTTTCATGTTTAGTTATGTACTGTAATATGCATTTGAATCAAATCTGATTACAAGAGTAAAACCAATACATACTAATAAAATGGATTGTATATCTGTACAGGTATCTGTTCCAACTGAATCAAGCTGCACATTTACTGCATTACCAACTTGTTTGTTTGCAGGATGTGATTGAAACACAAGAAAGGACCATTACAGATCTGCTTAGATCTGTTAAAGAGCAACATGACCAGCTTAACTACCAGAAG
Associated Phenotype:
Not determined