Busch Lab

ZMP

zranb2

Ensembl ID:
ENSDARG00000044332
ZFIN ID:
ZDB-GENE-040426-2743
Description:
zinc finger Ran-binding domain-containing protein 2 [Source:RefSeq peptide;Acc:NP_998572]
Human Orthologue:
ZRANB2
Human Description:
zinc finger, RAN-binding domain containing 2 [Source:HGNC Symbol;Acc:13058]
Mouse Orthologue:
Zranb2
Mouse Description:
zinc finger, RAN-binding domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1858211]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa25343 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa25343
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104180 Essential Splice Site 19 314 None 10

The following transcripts of ENSDARG00000044332 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 37249991)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 37323749
GRCz11 6 37301643
KASP Assay ID:
554-7679.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGAAGAGTTTTCGCGTTAGCGACGGAGACTGGATTTGTCCTGATAAAAAG[T/G]AAGACTTGCTGCTGAATGGTTTATTAATTGATGCATATAGATATATACAT
Associated Phenotype:
Not determined