Busch Lab

ZMP

zgc:111821

Ensembl ID:
ENSDARG00000044276
ZFIN ID:
ZDB-GENE-050706-97
Description:
spp1 protein [Source:RefSeq peptide;Acc:NP_001002308]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa38784 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27577
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065008 Essential Splice Site 33 213 3 7
ENSDART00000081518 Essential Splice Site 56 160 4 9
ENSDART00000101261 Essential Splice Site 56 305 4 8
Genomic Location (Zv9):
Chromosome 10 (position 15155707)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 15169014
GRCz11 10 15127133
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTATTCTTCGAAAAGCTGCTGCCAATGTGTTCCAGGTAGAGCCTACACAG[G/A]TAAACCCCATTAATAAATTACTTAAAAAGGCACTTGGTTTTTAAAGTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38784
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065008 Nonsense 151 213 6 7
ENSDART00000081518 None None 160 8 9
ENSDART00000101261 Nonsense 174 305 7 8
Genomic Location (Zv9):
Chromosome 10 (position 15150962)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 15164269
GRCz11 10 15122388
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACTGGGCGGCTTGACATTTGTGAGCAAGAAGACGTCTGCCTATGATGAT[C/T]AGAGCATCAATGACGTGGAGAAAGAGATTACACTGTACAAGGTAAAGAGA
Associated Phenotype:
Not determined