Busch Lab

ZMP

ENSDARG00000044264

Ensembl ID:
ENSDARG00000044264

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa33809 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa33809
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064991 Nonsense 136 271 3 6
Genomic Location (Zv9):
Chromosome 6 (position 8268376)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 9222780
GRCz11 6 9458319
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCAGGCTGCCCACATGTGCTGTCAGCGAGGGGTCCTCCATCGGGACATT[A/T]AATTAGAAAACCTGCTGATAAACAAGGAAACTTTAGAAGTTAAACTCATC
Associated Phenotype:
Not determined