Busch Lab

ZMP

si:ch211-243g18.2

Ensembl ID:
ENSDARG00000044261
ZFIN ID:
ZDB-GENE-030131-2830
Description:
hypothetical protein LOC559906 [Source:RefSeq peptide;Acc:NP_001038375]
Human Orthologues:
AC090051.1, KRT14, KRT16, KRT18, KRT20, KRT23
Human Descriptions:
Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:C9JEA8]
keratin 14 [Source:HGNC Symbol;Acc:6416]
keratin 16 [Source:HGNC Symbol;Acc:6423]
keratin 18 [Source:HGNC Symbol;Acc:6430]
keratin 20 [Source:HGNC Symbol;Acc:20412]
keratin 23 (histone deacetylase inducible) [Source:HGNC Symbol;Acc:6438]
Mouse Orthologues:
Krt14, Krt16, Krt18, Krt20, Krt23
Mouse Descriptions:
keratin 14 Gene [Source:MGI Symbol;Acc:MGI:96688]
keratin 16 Gene [Source:MGI Symbol;Acc:MGI:96690]
keratin 18 Gene [Source:MGI Symbol;Acc:MGI:96692]
keratin 20 Gene [Source:MGI Symbol;Acc:MGI:1914059]
keratin 23 Gene [Source:MGI Symbol;Acc:MGI:2148866]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa9712 Essential Splice Site Available for shipment Available now
sa14032 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9712
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028855 Essential Splice Site 266 428 4 8
ENSDART00000064977 Essential Splice Site 266 428 5 9
ENSDART00000136281 None None 116 None 3
Genomic Location (Zv9):
Chromosome 10 (position 9649918)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 9725874
GRCz11 10 9559433
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCATTGWCCAGAAGAACAAGGAGGAAGCTGAGAGCTGGTACCGTAAAAAG[G/A]TTTGTGCTCTCAGGGGAACAGGGTCAGAACCAGTACCATGGCTGCCAGYC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14032
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028855 None None 428 None 8
ENSDART00000064977 None None 428 None 9
ENSDART00000136281 Nonsense 116 116 3 3
Genomic Location (Zv9):
Chromosome 10 (position 9655952)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 9731908
GRCz11 10 9565467
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGAGTGAGTTCTCATCCATTCTCAATGTGTCACTTKTTGGWTTCAGCAAA[C/T]AGTAGATCAAATATGCACAAACTWAACTTGCTTCTAACAWACATTTGACT
Associated Phenotype:
Not determined