Busch Lab

ZMP

rasgef1bb

Ensembl ID:
ENSDARG00000044251
ZFIN ID:
ZDB-GENE-040801-220
Description:
Ras-GEF domain-containing family member 1B-B [Source:UniProtKB/Swiss-Prot;Acc:Q6DBW1]
Human Orthologue:
RASGEF1B
Human Description:
RasGEF domain family, member 1B [Source:HGNC Symbol;Acc:24881]
Mouse Orthologue:
Rasgef1b
Mouse Description:
RasGEF domain family, member 1B Gene [Source:MGI Symbol;Acc:MGI:2443755]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa13833 Essential Splice Site Available for shipment Available now
sa21670 Nonsense Available for shipment Available now
sa21671 Nonsense Available for shipment Available now
sa9906 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13833
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064968 Essential Splice Site None 475 2 14
Genomic Location (Zv9):
Chromosome 10 (position 9255209)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 9331165
GRCz11 10 9164724
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGATGCTGCCATGCATCTTTCATACCTAATGACTAATGTTTTTTGWCCTY[A/T]GGWCCAACATGCCACAAACAACTCCATATTCAAGCAAATDCAATCCAAGT
Long Flanking Sequence:
GTGATTGTCACTCACGTGCACGAGCACAGATTTGCCTGTGATTTCAGGCATTTGTCGGCGATTTCTCAAAACCTGTGGCGAGCCAAAATCGGGGCTAAAATCACGCAATCTGAACTAGGCATAAGGCCCTGATATACTTCAAGCTATGTTGTATTTTTCATCGTTCAGGGGTAAAAAGAAGATCTAAGCAGCATTGTTCTATTAACAATCAGGGTTTACATCAAAATAAGCCACAAGTAAATGACAATGCTAAAAAACAAGAGTTTAAAATACTTGAAAACAAACTTTATTTTGGCCTGATTTAGTTTGAAATTACATCACTAAGTTTGTTCTTCAATATTTCTGGAAGAATGTAAGGGCTTTCAAACACCACATTAGCAAAATACAGACTGCGTGCATGTGTCCGCATTCATCTGGTGGTGGGTGTTCATTTCACACCTTATTTCGCAGAGATGCTGCCATGCATCTTTCATACCTAATGACTAATGTTTTTTGTCCTC[A/T]GGTCCAACATGCCACAAACAACTCCATATTCAAGCAAATTCAATCCAAGTGCTTACAGCAGCAGCCACAGTCACCGGCAGCCTGTGGAGGAGAACTATGGGGGTTTGCACTATCGTGATAATAAGCTTGTTTCTGGCTCTCTGGAAGCCCTCATACAGCTCTTGGTCCCTACAGTAGACTATTACCCTGACGTAAGTATACAGCCTTTATGCTTCCCTGCGATAATTACTATAATCTCTGGCTGGACAGTAAATGTCAAAACTTGACTGACGCTTGAGATCATCTTGTCCTTTTCACAGAGATCCTACATTTTCACTTTCCTGCTAAGCTCTCGCCTCTTTCTGAACCCATTTGAGCTCATGTCTCGGGTTTGTTACCTCGGTGTGGACCATCACAGGGTTGGAGACCCACAAATGGATAAGGTTTGTGCTGAAAAGTGGGCCATATGACATCATAATAGTATCTTTCCTGGAATGGAACAAAGAATGTATTTTATAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21670
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064968 Nonsense 16 475 2 14
Genomic Location (Zv9):
Chromosome 10 (position 9255265)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 9331221
GRCz11 10 9164780
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACATGCCACAAACAACTCCATATTCAAGCAAATTCAATCCAAGTGCTTA[C/A]AGCAGCAGCCACAGTCACCGGCAGCCTGTGGAGGAGAACTATGGGGGTTT
Long Flanking Sequence:
GGCGATTTCTCAAAACCTGTGGCGAGCCAAAATCGGGGCTAAAATCACGCAATCTGAACTAGGCATAAGGCCCTGATATACTTCAAGCTATGTTGTATTTTTCATCGTTCAGGGGTAAAAAGAAGATCTAAGCAGCATTGTTCTATTAACAATCAGGGTTTACATCAAAATAAGCCACAAGTAAATGACAATGCTAAAAAACAAGAGTTTAAAATACTTGAAAACAAACTTTATTTTGGCCTGATTTAGTTTGAAATTACATCACTAAGTTTGTTCTTCAATATTTCTGGAAGAATGTAAGGGCTTTCAAACACCACATTAGCAAAATACAGACTGCGTGCATGTGTCCGCATTCATCTGGTGGTGGGTGTTCATTTCACACCTTATTTCGCAGAGATGCTGCCATGCATCTTTCATACCTAATGACTAATGTTTTTTGTCCTCAGGTCCAACATGCCACAAACAACTCCATATTCAAGCAAATTCAATCCAAGTGCTTA[C/A]AGCAGCAGCCACAGTCACCGGCAGCCTGTGGAGGAGAACTATGGGGGTTTGCACTATCGTGATAATAAGCTTGTTTCTGGCTCTCTGGAAGCCCTCATACAGCTCTTGGTCCCTACAGTAGACTATTACCCTGACGTAAGTATACAGCCTTTATGCTTCCCTGCGATAATTACTATAATCTCTGGCTGGACAGTAAATGTCAAAACTTGACTGACGCTTGAGATCATCTTGTCCTTTTCACAGAGATCCTACATTTTCACTTTCCTGCTAAGCTCTCGCCTCTTTCTGAACCCATTTGAGCTCATGTCTCGGGTTTGTTACCTCGGTGTGGACCATCACAGGGTTGGAGACCCACAAATGGATAAGGTTTGTGCTGAAAAGTGGGCCATATGACATCATAATAGTATCTTTCCTGGAATGGAACAAAGAATGTATTTTATAAGCATGTGGTAATGTCTGTGTTTGGATCCAGCGAATTAAATAAGCGTCACAAATAAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21671
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064968 Nonsense 261 475 7 14
Genomic Location (Zv9):
Chromosome 10 (position 9264161)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 9340117
GRCz11 10 9173676
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTCTTCAGAGTTTCTTCAGTAAAAGAAAAGCAAGCAACCTGGAGGCTTA[T/A]GTCGAATGGTTCAACAGACTGAGCTACCTGACAGCCACAGAAATTTGCAT
Long Flanking Sequence:
AGTTCATGAGTATTAAGTAGTTAAAGCGTTGTAAATACTCGCGATCGTCTTCCTCGCGACAGAGCGCGTATGAGGTAAATGACGTCAGTAATAACCGGTTATGATTATTACTGAACTGATACCGAATTGTCCGCGTCTGCATCGCGGTGCATTGAAGAAACGATTAATTTTGACACCCCTATTGACAAACTAGTATCACACTATTAATCATATTAGCAAGTTATGTACAATTTGCATTCAGCCCTGAAGCTGCTGTCATGTTTTCCAGGAGCGCCTCAGCTACATTGGCCCTGAAGAATTCGTTCGAGCGTTTGCCCAGAAAAGACCCTCAGATAACCATAAGGTAAGCAGTCATACACCTCTATTTAAAGATTACACAAGTACACTGTAAATAGAATGGACACAGACAGGAAGTTAGTCAGACTATTTCAGTGACAATTGAACTTTTTTCTTCTTCAGAGTTTCTTCAGTAAAAGAAAAGCAAGCAACCTGGAGGCTTA[T/A]GTCGAATGGTTCAACAGACTGAGCTACCTGACAGCCACAGAAATTTGCATGGTGAGCACACCTTTCATCTATTTTGGGTGCAAACCCAAATAGTGCCTGCAGGCATAAATCTTATCTTTTGTTATTGTCGTCAAAGGCTGTGCAACCACTCTGTCACATACATAATGCTTAATTTACAATGTAAAATCTGCATCCTGAAGCGAAACCCGTTGAAGGAAGAGTTCACTTGAAAAAAAAAAAGTTTTTTTTTTTTTCAACTAGAGCCCTAAGAAACCAGTGGATTTATGATTTAAAGTTTAGTCATTTAGAGCAATTGTTTATGTAAAATAACAAAATAAGATTCTTTGATTCTATGAATTTTTTGACAAAATTGTTTTAATGATTATAAGGGTATGATTTCAGCATTTGATGGAATACCCCTGATGAAAGCATTTATGTTGACCAGTGCGCGTTTTCTAATATAAAAAGATACTAAATGAACTTTATACAATAAAAAAATA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27564
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064968 Nonsense 308 475 8 14
Genomic Location (Zv9):
Chromosome 10 (position 9264895)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 9340851
GRCz11 10 9174410
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTCATAGATGTGGCACAGGAATGCTTCAACATCGGCAACTTCAACTCAT[T/G]AATGGCTATCATTAGTGAGTACATGATGAATTATAATGTTATGATGACTT
Long Flanking Sequence:
AAAAAAAGTTTTTTTTTTTTTCAACTAGAGCCCTAAGAAACCAGTGGATTTATGATTTAAAGTTTAGTCATTTAGAGCAATTGTTTATGTAAAATAACAAAATAAGATTCTTTGATTCTATGAATTTTTTGACAAAATTGTTTTAATGATTATAAGGGTATGATTTCAGCATTTGATGGAATACCCCTGATGAAAGCATTTATGTTGACCAGTGCGCGTTTTCTAATATAAAAAGATACTAAATGAACTTTATACAATAAAAAAATATATTAACATTTTATTTAAATCCATGCTTAATAAATCAAGATGAACTGAGAGTTTTTTCAGTGGTCTCTTAATATTTTCCATAGCTACAGTTGTGTTTGATCTGCAATCATTGACACTGTTCTGCCCTCTGCTGGTTTGTCTTCAGCCGGTGAAAAAGAAACACAGGGCAAGAGTGCTGGAGTTCTTCATAGATGTGGCACAGGAATGCTTCAACATCGGCAACTTCAACTCAT[T/G]AATGGCTATCATTAGTGAGTACATGATGAATTATAATGTTATGATGACTTATTTCACAAAAATGATGTTAGCTTTTTAAAATGAAATGTTAGTGTTATATAATACTAATACACGATCATTATTTCACTTAGCTGGAATGAACATGAATCCAGTATCCAGACTGAAGAAAACCTGGGGCAAAGTCAACACAGACAAGTTTGACATCCTGGTGGTAAGAAAGCTTTTACAAGAAAGACGGAAAGATACGTTATGGGGTCAAACCCTCTCGGACCATCTAATTTAAATGGGTCATATTAAGCTTTTTTCTCTTTCTTTAGTGTGTGATGTTGCTGTTTGTAAATGAAAAAGTCTGCAAAGTTACAAAGAACAAATCCACTTATTTTCCATATTCTATGTCAGTATTACTATTTCTATTTACATCATCACTAGCACTGAGATAACAGTAAAATAATTAATGATGCCTACATTTGTAATAAAAATCCCATTTTGAAAGCAACTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9906
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064968 Essential Splice Site 313 475 9 14
Genomic Location (Zv9):
Chromosome 10 (position 9265025)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 9340981
GRCz11 10 9174540
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AATKAAATGTTAGTGTTATATAATACTAATACAYGATCATTATTTCACTT[A/T]GCTGGAAYGAACATGAATCCAGTATCCAGACTGAAGAAAACCTGGGGCAA
Long Flanking Sequence:
GACAAAATTGTTTTAATGATTATAAGGGTATGATTTCAGCATTTGATGGAATACCCCTGATGAAAGCATTTATGTTGACCAGTGCGCGTTTTCTAATATAAAAAGATACTAAATGAACTTTATACAATAAAAAAATATATTAACATTTTATTTAAATCCATGCTTAATAAATCAAGATGAACTGAGAGTTTTTTCAGTGGTCTCTTAATATTTTCCATAGCTACAGTTGTGTTTGATCTGCAATCATTGACACTGTTCTGCCCTCTGCTGGTTTGTCTTCAGCCGGTGAAAAAGAAACACAGGGCAAGAGTGCTGGAGTTCTTCATAGATGTGGCACAGGAATGCTTCAACATCGGCAACTTCAACTCATTAATGGCTATCATTAGTGAGTACATGATGAATTATAATGTTATGATGACTTATTTCACAAAAATGATGTTAGCTTTTTAAAATGAAATGTTAGTGTTATATAATACTAATACACGATCATTATTTCACTT[A/T]GCTGGAATGAACATGAATCCAGTATCCAGACTGAAGAAAACCTGGGGCAAAGTCAACACAGACAAGTTTGACATCCTGGTGGTAAGAAAGCTTTTACAAGAAAGACGGAAAGATACGTTATGGGGTCAAACCCTCTCGGACCATCTAATTTAAATGGGTCATATTAAGCTTTTTTCTCTTTCTTTAGTGTGTGATGTTGCTGTTTGTAAATGAAAAAGTCTGCAAAGTTACAAAGAACAAATCCACTTATTTTCCATATTCTATGTCAGTATTACTATTTCTATTTACATCATCACTAGCACTGAGATAACAGTAAAATAATTAATGATGCCTACATTTGTAATAAAAATCCCATTTTGAAAGCAACTGCATCCTTCAAATAAAGATTGTTGCAATTAAATCATTGTACAGCAATAGGTGGAATCAGGCATCCATTTAAAATGTATTTGTTACTGAATAATTTAATAGATTTTCCAAAAATGCTGATTAATCCAGTCTTG
Associated Phenotype:
Not determined