Busch Lab

ZMP

zgc:66317

Ensembl ID:
ENSDARG00000044167
ZFIN ID:
ZDB-GENE-031116-67
Description:
protein-arginine deiminase type-2 [Source:RefSeq peptide;Acc:NP_956406]
Human Orthologues:
PADI1, PADI2, PADI3, PADI4
Human Descriptions:
peptidyl arginine deiminase, type I [Source:HGNC Symbol;Acc:18367]
peptidyl arginine deiminase, type II [Source:HGNC Symbol;Acc:18341]
peptidyl arginine deiminase, type III [Source:HGNC Symbol;Acc:18337]
peptidyl arginine deiminase, type IV [Source:HGNC Symbol;Acc:18368]
Mouse Orthologues:
Padi1, Padi2, Padi3, Padi4, Padi6
Mouse Descriptions:
peptidyl arginine deiminase, type I Gene [Source:MGI Symbol;Acc:MGI:1338893]
peptidyl arginine deiminase, type II Gene [Source:MGI Symbol;Acc:MGI:1338892]
peptidyl arginine deiminase, type III Gene [Source:MGI Symbol;Acc:MGI:1338891]
peptidyl arginine deiminase, type IV Gene [Source:MGI Symbol;Acc:MGI:1338898]
peptidyl arginine deiminase, type VI Gene [Source:MGI Symbol;Acc:MGI:2655198]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa40787 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa38578 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa40787
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064842 Essential Splice Site 110 647 3 16
ENSDART00000127766 Essential Splice Site 136 701 3 16
ENSDART00000140943 Essential Splice Site 136 299 3 7
Genomic Location (Zv9):
Chromosome 6 (position 47791278)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 47851930
GRCz11 6 47850689
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAGAAAACGGAGACGCTTGGGGACGCCATACTGCATCTTACAGCTGTTG[G/A]TATGTGTCTGCTGTGTGTACATTGCACTTAATGTGAGACATACGCCTATA
Long Flanking Sequence:
AAGAATGTGTGGAAGTTTTCTGTGCTTTCTACTTCTGCAAATCCTAATGAACGCAAACAATGTGATAGAATGTTTGAAACTGGGCATATACTTTGCATAGATATTTGCATAGATATTAGTTCTATAAAAAGGAACTAAAAACCTTAACTTGACAGACAGGAAAGAGCTTGACTTGTTAGTTATTCAGTAACAGTGTGGTTGACGCTGGTATTAGTCTATTGAGGAAACTGAGGTTTGCATGTCTCACACTACTTTCACAACACTGTCTAGCACTGGCAGTTAATTCTGCATATGTCACACATATTTTAATACAATCATTATCATGCCAAAATGAATCTGCTGTAATTTTCAAAGAAAACCATAATAATTGCACAATAATTGTTCTAATGATCCAGCTCATCCTTGTTTCTAAGAATCTGATTGATTTCAGTTGTCTGTGAGATACTACGGTGAGAAAACGGAGACGCTTGGGGACGCCATACTGCATCTTACAGCTGTTG[G/A]TATGTGTCTGCTGTGTGTACATTGCACTTAATGTGAGACATACGCCTATATTTATGGCTAACGCTTGTGTAAACGGAATCTGTGGTGCAACTATAAACAGTCTTATGATGCTGGCATGACTGTGACCGAGCGAGTCTCTTAATTCTGTTGTCTGTGTTCTGTTGCAGAGATATCTCTGGATGTAGATGCTGACCGAGATGGTGTTGTTGAGAAAAACAATCCAAACAAGGTGAGCTTTGTTTGTGGTCAGTCCTGTATCATAATTAATAGGGAGATTAATTTTTGAAGCTTTGTTTCTAAGTTGAAGATGGGGATCAAGAAGTCAGATAAAATAGTTAGTTGATAATAATTAAAAAATTATTAAATTAAATTATTAAATAATTAAATAGTTGATTCTAAACATCTCGTCCTGATGGCAAAGACAGTTTACCCAAAAATACAACAACAGTCTTGTTTCCAGCCTGCATAATTGAACCGTTTAAATGCATTTACAATTTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38578
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064842 Nonsense 172 647 6 16
ENSDART00000127766 Nonsense 198 701 6 16
ENSDART00000140943 Nonsense 198 299 6 7
Genomic Location (Zv9):
Chromosome 6 (position 47795740)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 47856392
GRCz11 6 47855151
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGTGTGAAGAAGAGCTGAGTAATGTTCTTTTTTTTGTTTTTTGGCAGATT[T/A]GAAGGACATGTCCAAGATGGTGTTGCGCACTAATGGACCATCTCAACTTC
Long Flanking Sequence:
TGCTTTTCTTATTAATCATTCATTATTAATACTATTCAGCCAGAAAGTATTGAAAAGTGTCTATAGAATATAATTCAGCCTAATAAAAACATTTACTCAACTATTTCATCACATTTAAATGGTTCCAAATCATTATGAGTTCATTTTTTTTTCTGTTCAACTCACAAGGAGATATTTTGAAGAATGTTAGAAACTGGTAAACATTGACTTCCGTATTGGGAAAAACAAATACTGTTGAAGTCGATATATACTGGTTTTCAACATTTTTCAACATAACTTCTTTGAGTGTTTAACAGAATAATGAAATCTCACAAGTTAATTGTAAAAAAAATTATGAAAATGTGTGTCTTTCTGACTATTCCTTTTAAATAGATATTTTTTTTCCTATTGTACAATTGTCTGTGCATATTGCGCTGTTAGCTTGGTTAACATCTACTTTACAAAAGCAGTGGTGTGAAGAAGAGCTGAGTAATGTTCTTTTTTTTGTTTTTTGGCAGATT[T/A]GAAGGACATGTCCAAGATGGTGTTGCGCACTAATGGACCATCTCAACTTCCTGAAGGCTATAAGCTGAGCATGCACATCTCGCAGAGCACTTCAGAGAGTGTCAGAGTCTTTAGACCTCGCACAAACACAAAAACAGAAAACTTGTGGAGTGAGTCAAGTATAATAAGAAGAAAAATAATCAATGTTTTAATGTTAAGTAGAAGTTTTAGTTGACCACAAAGAGTTCATCATTTTTTCGCCCTCATGTTGATAGTTTGTTTAAAAACTCAGCAATATTTTAAACATATAATATATTTATACACAGCTGTGGAAAATGTAAGATACTACATAATTGCTCATTTTAAGTTTTCTAGGAATGGGTTTGAGTAAAGCCTTAATAGTTATTTCATTGTAAAAATGTCTGATTACATTTCTTCCAAAGTTTAAATGAAAAATATTGTCATTTAGAGTAATTTCTTTGAGAAAATGGCAGCAGGTTTGGTGGTTATTCCATCAAATG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26822
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064842 Nonsense 599 647 16 16
ENSDART00000127766 Nonsense 653 701 16 16
ENSDART00000140943 None None 299 None 7
Genomic Location (Zv9):
Chromosome 6 (position 47805861)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 47866513
GRCz11 6 47865272
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCCAAAGCCATTCGGCCCACAGGTGAAGGGTGTGTGTGCGCTGGAGAAA[G/T]AAATGTGTTCTCTTCTGGAGCCTCTGGGCCTCAAATGCACCTTCATCGAC
Long Flanking Sequence:
TTAATTTAGGATATATTTTAATATGCTGATCTGATGCTCCAGATACATTTCTTCTTATTATTTTTATTAATATTTGTTATTATTATTATTATTATTATTAATAATAATAATAATAATAATAAAAATAATAATGTTATTATGTTTAAAGCTGTTGTGCCACTTAAATTGTTTTTAGAAACCGTGATATGTTTTTTTTTTTTATCAATAGAGAGTTCAAAAGTACTTCATGTAAATGTAAATTGTCAAAAAAGGTCTTCAGAGCACAAAATATTACTGAAATATTATTTAAATAAAACACTCATAATAAAATCATCACCATATTCAAAACACACCTGGAATGTGCTTGAAACGTGGTTAAATTTGACTCTGGAAAAGGTGTAAGATTCCGGATTACCTGTGTTTGTTTGTCTCCTCAGGTGAACATGATCGTGTTGGGTGATCAGCTGGGTATCCCAAAGCCATTCGGCCCACAGGTGAAGGGTGTGTGTGCGCTGGAGAAA[G/T]AAATGTGTTCTCTTCTGGAGCCTCTGGGCCTCAAATGCACCTTCATCGACGATTTCGCCCCGTATCACAAACTGCTGGGTGAAGTTCACTGCGGGTCCAATGTTCTCCGAGAACCTTTCACCGTCAGGTGGTGGAACCTGGAGCTGTAAGACACAAACCAGACCTTTCAAAGTGCCTATCACGATTAAAGCAGGATTAATAGCTTAATGGGTGTCTAAACTAGCAATAAATAAATAAACACGGAGCAAAACACTATGATAATTGATGGAGGAATGGAAAGTCTTATTTACTCACCCTCATGTTGTTCAAGCCGCTTTCTAGTGTCAAAGTACAAAAAAAAACTGTGATTTGTTGTGAAGTATGTTGTTCTATATATATTTTTTCACCCACACATTGATATCTGAGAGCTTTGGATTTTCGGAAGAATCGCATATCTTTGTAAGGACATGACTGTGAGCAAATTACAATCTTTCATATCCTCTTAGTGATATTTCTAAATT
Associated Phenotype:
Not determined