Busch Lab

ZMP

Q58EF5_DANRE

Ensembl ID:
ENSDARG00000044144
Description:
KIAA0261 protein [Source:UniProtKB/TrEMBL;Acc:Q58EF5]
Human Orthologue:
WAPAL
Human Description:
wings apart-like homolog (Drosophila) [Source:HGNC Symbol;Acc:23293]
Mouse Orthologue:
Wapal
Mouse Description:
wings apart-like homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2675859]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa42941 Nonsense Mutation detected in F1 DNA Not yet available
sa45608 Nonsense Mutation detected in F1 DNA Not yet available
sa12782 Nonsense Available for shipment Available now
sa42942 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa42941
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064817 Nonsense 3 1062 2 17
ENSDART00000122105 Nonsense 3 1153 1 19
Genomic Location (Zv9):
Chromosome 17 (position 25699994)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 25839913
GRCz11 17 25858304
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACGTGTTTTACTTCTTTATAGATAATATGTAACAAGCGACAAAATGACAT[C/A]AAGATTTAGTAAAACGTACACGCGGAAGGGAGGAGAAGCCAGCTCAAAGT
Long Flanking Sequence:
TCAACTTCTATTTGGTTTAGTCCCAGAGCTCTGAGGGTCAATGAAGATTATAAATGCATTTATTTGTGTACAGTAACCAAGAAGAAGATGACAAGTAACGGCAGTCCTGAGCTTCATCAGTCTATATTATATGTTTTCTAATATTCATCAGTCTATATGAATTCATGGAGTCTAAAAATATATAATATATTTTATTTAATATATAAACAATATAATTTTTAGTCATATTTGCCTGAAGGTTTATATTTTAAGAATTCTATTTAAGTGGCTTTCAGTTGCTAAAATTTATTATTCAAACACGTTATATCTAACAAGTTCTAACTTCTAAGACATCTAAGAAAGGTTTATATATCAAGTTTGTGTATTTCAGTTTCACTGTAGCATTTAGAACTAAATGTAAACCTCCTTGTTCCTACATAATCCAAGTTTGATAAGTTAACCTTTATTTTAACGTGTTTTACTTCTTTATAGATAATATGTAACAAGCGACAAAATGACAT[C/A]AAGATTTAGTAAAACGTACACGCGGAAGGGAGGAGAAGCCAGCTCAAAGTTTGACGAAGTGTTCTCTAACAAGAAAGCTACACTCACCACCAAATGGGGAGAGTCCACCTACAAGGCGCATTTGGGCATCAAACGACCCTCATTCAAGCCAGATGTTTCAGAGCTGACCAAACGACCCCGCTTTGATGATGACGACAGCTCAGAGGATCCGTTTGGCTTTGACAGCGATGATGAGTCCAAAACAGTCACATCCAGAGATACTGCTCAATCTGAGATGGACTCGGATACTGCAGGACCCAAGAATGAGCAGTTAAAGACCCGGATGGAAAAGCCCAGCGGGGGGACACTGGTGACCAGTACTTCTTCCTTGGGGAGTAGTACAAACATCAGCAGAGGGGCGGTTGGCGTGAATAGCCCAGGTAAGAAATCTGTTAAATCAGCGCATCATTATTGCAACAACACTTGTGTGGGATATTGTACACCAATATGAAAATGATCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45608
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064817 Nonsense 44 1062 2 17
ENSDART00000122105 Nonsense 44 1153 1 19
Genomic Location (Zv9):
Chromosome 17 (position 25700117)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 25840036
GRCz11 17 25858427
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAAAGCTACACTCACCACCAAATGGGGAGAGTCCACCTACAAGGCGCATT[T/A]GGGCATCAAACGACCCTCATTCAAGCCAGATGTTTCAGAGCTGACCAAAC
Long Flanking Sequence:
ATATTATATGTTTTCTAATATTCATCAGTCTATATGAATTCATGGAGTCTAAAAATATATAATATATTTTATTTAATATATAAACAATATAATTTTTAGTCATATTTGCCTGAAGGTTTATATTTTAAGAATTCTATTTAAGTGGCTTTCAGTTGCTAAAATTTATTATTCAAACACGTTATATCTAACAAGTTCTAACTTCTAAGACATCTAAGAAAGGTTTATATATCAAGTTTGTGTATTTCAGTTTCACTGTAGCATTTAGAACTAAATGTAAACCTCCTTGTTCCTACATAATCCAAGTTTGATAAGTTAACCTTTATTTTAACGTGTTTTACTTCTTTATAGATAATATGTAACAAGCGACAAAATGACATCAAGATTTAGTAAAACGTACACGCGGAAGGGAGGAGAAGCCAGCTCAAAGTTTGACGAAGTGTTCTCTAACAAGAAAGCTACACTCACCACCAAATGGGGAGAGTCCACCTACAAGGCGCATT[T/A]GGGCATCAAACGACCCTCATTCAAGCCAGATGTTTCAGAGCTGACCAAACGACCCCGCTTTGATGATGACGACAGCTCAGAGGATCCGTTTGGCTTTGACAGCGATGATGAGTCCAAAACAGTCACATCCAGAGATACTGCTCAATCTGAGATGGACTCGGATACTGCAGGACCCAAGAATGAGCAGTTAAAGACCCGGATGGAAAAGCCCAGCGGGGGGACACTGGTGACCAGTACTTCTTCCTTGGGGAGTAGTACAAACATCAGCAGAGGGGCGGTTGGCGTGAATAGCCCAGGTAAGAAATCTGTTAAATCAGCGCATCATTATTGCAACAACACTTGTGTGGGATATTGTACACCAATATGAAAATGATCATACACGAGTAGACATCTCAAGTTATTTCAATTCTGTATGACTTGCTTTGTTTTTTGTGCTAAGGGTGTTCAGAACTGGTTAGTGAATGATTCATTCTTCAGTTTTGTGAACTAGATCATCTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12782
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064817 Nonsense 48 1062 2 17
ENSDART00000122105 Nonsense 48 1153 1 19
Genomic Location (Zv9):
Chromosome 17 (position 25700128)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 25840047
GRCz11 17 25858438
KASP Assay ID:
2261-1111.1 (used for ordering genotyping assays)
KASP Sequence:
TCACCACCAAATGGGGAGAGTCCACCTACAAGGCGCATTTGGGCATCAAA[C/T]GACCCTCATTCAAGCCAGATGTTTCAGAGCTGACCAAACGACCCCGCTTT
Long Flanking Sequence:
TTTCTAATATTCATCAGTCTATATGAATTCATGGAGTCTAAAAATATATAATATATTTTATTTAATATATAAACAATATAATTTTTAGTCATATTTGCCTGAAGGTTTATATTTTAAGAATTCTATTTAAGTGGCTTTCAGTTGCTAAAATTTATTATTCAAACACGTTATATCTAACAAGTTCTAACTTCTAAGACATCTAAGAAAGGTTTATATATCAAGTTTGTGTATTTCAGTTTCACTGTAGCATTTAGAACTAAATGTAAACCTCCTTGTTCCTACATAATCCAAGTTTGATAAGTTAACCTTTATTTTAACGTGTTTTACTTCTTTATAGATAATATGTAACAAGCGACAAAATGACATCAAGATTTAGTAAAACGTACACGCGGAAGGGAGGAGAAGCCAGCTCAAAGTTTGACGAAGTGTTCTCTAACAAGAAAGCTACACTCACCACCAAATGGGGAGAGTCCACCTACAAGGCGCATTTGGGCATCAAA[C/T]GACCCTCATTCAAGCCAGATGTTTCAGAGCTGACCAAACGACCCCGCTTTGATGATGACGACAGCTCAGAGGATCCGTTTGGCTTTGACAGCGATGATGAGTCCAAAACAGTCACATCCAGAGATACTGCTCAATCTGAGATGGACTCGGATACTGCAGGACCCAAGAATGAGCAGTTAAAGACCCGGATGGAAAAGCCCAGCGGGGGGACACTGGTGACCAGTACTTCTTCCTTGGGGAGTAGTACAAACATCAGCAGAGGGGCGGTTGGCGTGAATAGCCCAGGTAAGAAATCTGTTAAATCAGCGCATCATTATTGCAACAACACTTGTGTGGGATATTGTACACCAATATGAAAATGATCATACACGAGTAGACATCTCAAGTTATTTCAATTCTGTATGACTTGCTTTGTTTTTTGTGCTAAGGGTGTTCAGAACTGGTTAGTGAATGATTCATTCTTCAGTTTTGTGAACTAGATCATCTAATGTATTGAAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42942
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064817 Nonsense 760 1062 11 17
ENSDART00000122105 Nonsense 760 1153 10 19
Genomic Location (Zv9):
Chromosome 17 (position 25714717)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 25854636
GRCz11 17 25873027
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGGTCATTTAGCAATGGAAACGCTGCTGTCTCTGACGTCGAAGCGAGCT[G/T]GAGACTGGTTTAAGGAGGAGCTGCGTTTACTTGGGGGACTGGACCACATC
Long Flanking Sequence:
ATATTGCAGAAATGTATATCGCAATGTCATATTTTTCCAATATTGTGCAGCCCTATTTCATGTTATTATAAATGCTGAAAACATTGTGCATTTTAAATATATTTGTGTTATAGCTTCACAAACTTTTCAGGATACTTCAGATAGAGTAAAAAAACAAGACTCAATAAAATGTATTACAAAAATATAAATGTCATTACAGTCACAATCAGTTCCTTGCATTCTTACTGTGAAAAAAAAATATGTGTGGGTGTGTATGTGTGCATTTCAAAAATTAACTGACCCAAAACTTTTGAACTTGTGTAACAGGCCTGTTAGATAAGTGTTTTTGTCAGTTCACATTTATAAAGTGCTACTAAAGTAAAAAAAAAAAAAACTAATTGCAAATAATTGTATTATTTATTTTTATTTTATTTTTTACTTTATGTGCTCATCTCATTTCTTAATTTCAGACTGGTCATTTAGCAATGGAAACGCTGCTGTCTCTGACGTCGAAGCGAGCT[G/T]GAGACTGGTTTAAGGAGGAGCTGCGTTTACTTGGGGGACTGGACCACATCGTAGATAAAGGTGTGTATCTCTTTTCTGATTTATACATTGTGTATATCGCTATCTGATTTATATTTGTGAAAGGAATGGTTAGCAATGACTTTTTCTCCTCAGTAAAAGAGTGTGTGGAGAACTTGAATAAAGAAGAAGATAAAGAGAGTCTAGTGGCGTCACTCTGGGGAGCAGAACGCTGCTTGCGAGTTCTGGAGAGCGTGAGTGCACAACATGCTAGATGATCAAATCGTAATTGGTGTTGCTTTTCTTTGAAAATGCCTGCAGTAATTGCATAATATCACAGACTGTAGAATAAAGTGTTGTCAATGTGTAAAAAATAGAGGCTGAGAGATATACAAATCAAGTACTTAAGCAAAAAAAATAAATAAATAAAGTCCTAAAAATAAAAATTAAGTATTTGCATTAAGCAAATTATATTCTAATATTATAATTACTTGATCATTTTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28864
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064817 None None 1062 None 17
ENSDART00000122105 Nonsense 1150 1153 19 19
Genomic Location (Zv9):
Chromosome 17 (position 25726195)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 25866114
GRCz11 17 25884505
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCTGTTGGAACCACAGGACAGAAATCTATCTCACGGGTGATTGATTATT[T/A]GGAGCACTGTTAGCAGAGGTGTCGCAGTTCCCCCTCCTACTCCGTGGGAT
Long Flanking Sequence:
AAAACCAAGATCTGCCAAATCATCTTGGATCATTTAAGTGAGGTATGAAGAACGGACCCCTGGTGTTTGTATTCATAATGGATTGTTTTGAAAACTTTGTGTAAATGTGAAACATAAGAGTAAAGTTTTGAAAATTTGATTGTCAGCTCAAACATTGCTAAAAAACAATTCAAATATTATCATAAACAATAAATATCACTCACCTCTTCTTGCTTGTATACGGATATTGAAAAGAGATGTGGTTTCTGTGGTCAAATCAGTGTGTCTTGGCTGTTTTTCTACCTGGATTTGAATGTGCTTTCCAGCTGTGAACTGGTCTCTATTCATGCAGTCTAATCCCAGGTGTGAGATTGCCATTGATCTTCCGAAATATGTGGCTGTGCTTTGAAATGTGGCCAGTGACATTTAAATCAGCTTTTAACACGTCTGTGCTCTTTCCTGTCATCAGTGTTCTGTTGGAACCACAGGACAGAAATCTATCTCACGGGTGATTGATTATT[T/A]GGAGCACTGTTAGCAGAGGTGTCGCAGTTCCCCCTCCTACTCCGTGGGATAAATCTGGACCTGGCAATGTGCCTTAGGCCCTTCAGGACAACAGAAAGCAGATCTGGTGGTAAAGGTGGCTAAGCATCGCTACAGAGACTTTCATGATTCTTTTCTCTCTCTTTTTTTTTTTTTTTTTTGCTTGTGCTTTTTATCTTTTTCAAATGCTGTCTTTGTCATGCTCACACACAAACACACACTTTCAGCTGTGTGTTTAGCAGAATATTTTGTTTTTGAAGCACTGATGAAATGATGAAAACTGTTTGATCAGAAGTATAATTTTAAGCTAGCTGTTCTTGTTTGTAGTGTTGAGATTTACCCTAAACAGAGTAACTTTATTGATATTTCAAACACTTGAGCTCTGAGGCTTTGTTCACACTGCAGGCAAATCTGATTTGGTTTTAAAATCCTCCTATTACGACTGACTGTTTGCACATGATATTTGCTCAGATAGTCTTTTA
Associated Phenotype:
Not determined