Busch Lab

ZMP

iars2

Ensembl ID:
ENSDARG00000044134
ZFIN ID:
ZDB-GENE-030616-608
Description:
isoleucyl-tRNA synthetase, mitochondrial [Source:RefSeq peptide;Acc:NP_001157270]
Human Orthologue:
IARS2
Human Description:
isoleucyl-tRNA synthetase 2, mitochondrial [Source:HGNC Symbol;Acc:29685]
Mouse Orthologue:
Iars2
Mouse Description:
isoleucine-tRNA synthetase 2, mitochondrial Gene [Source:MGI Symbol;Acc:MGI:1919586]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa28862 Nonsense Mutation detected in F1 DNA Not yet available
sa14246 Nonsense Available for shipment Available now
sa2910 Essential Splice Site Available for shipment Available now
sa17843 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28861
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064803 Nonsense 7 983 1 23
ENSDART00000138853 Nonsense 7 886 1 21
Genomic Location (Zv9):
Chromosome 17 (position 25431951)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 25571870
GRCz11 17 25590261
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCGGTGTGAAACTCGCCTGTCAGAGTTCCTCATGCTGCTGGTTCGGCGTT[C/A]GGCAGCAGGTTTCGGCGGCGTGGTGCGATGGGGACTGCGCTGTCTGTGCT
Long Flanking Sequence:
TTAAACTTGTAAAACTCATTCTTGATTTGATGATCACAGCAAGCTAAATCTTTTAATCCTGGTTGCTTTGTGCTTGTCCTGTCTTGTTGATATGTTTATTTTAACATCAGGAAATAAAAAAAGAGATTTATTGTCTTTATTTCACCCCAATGTGACAGTGGACACACTTTACCCACACACAGTTCTATCCAAACAGCTTACAAAATATGATTTTCATCATAGGTGCCCTTTAAAATGTTTTCCTGCTCAAACCCTTCGGACCTTTTAGCGACCCTACAGCGCCCTCTTGCGTTTTAAACCCGCACTGACATGCACAACGCGTTTTCGTTTATGTGCAAGTTTGTCTCTATGCAGCTTCCGTCGTTGTCCGTCGCTTCTATCGTTCCGGTAGAGAGCGAGTGCCGCCCATGCGGAGGAGGAGGAGGTCACATCCCACAACAATCTCTCATCCCGGTGTGAAACTCGCCTGTCAGAGTTCCTCATGCTGCTGGTTCGGCGTT[C/A]GGCAGCAGGTTTCGGCGGCGTGGTGCGATGGGGACTGCGCTGTCTGTGCTCCGGGGACGCGGCGGGCCGGTACCGAAACACCGTTCTGCTGCCCCGCACTGACTTCCCTATAAAAGTGAATGGGCCAAGCCTTCTAGAGCAAGAGATAAAGATCCAGCAGGTGAGTGACTGAGCTTGTCATTTACTGATTGAGGTAAATTTGGATTTATGTTCGTACATTAGTTCATTTTTGAGCAGTGACAACTTGTGACAGGGTCCCTATATTGTTTACTATGCTACTTTGAATATTCGGTCTGAAATGGCACGTAAGACTTCAAAACAACATCAGCACTATTACATTGACAGTGAACAATGCTGTAAGTTACTTTGATAGTCATTGGCTGCTAGTATGATGTGCCTATTTAGAATTAACAAAGAAAACATTACTCAAGTGGTATTATTTTTTTCAAAATAATTTTATTGCAAAGTACAGTAATAAAAAGACTAAAGCAATTATAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28862
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064803 Nonsense 75 983 2 23
ENSDART00000138853 Nonsense 75 886 2 21
Genomic Location (Zv9):
Chromosome 17 (position 25433162)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 25573081
GRCz11 17 25591472
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCTGTAGAAATGTGGTTTTGACCAGCTGTACAAATGGCAGAGAGAGAAA[A/T]AGGCTAAGAAGGAGTACTGTCTTCATGATGGACCACCGTATGCCAATGGG
Long Flanking Sequence:
ACATGTTCTTGCATATATTTTCTAAATGGGTCTCACATTTTCTTAAACTGGTTAGATTTTTTCAGCTTTAGAAAGAAGAGAACATCACGAATCCACTGTGTTGGGTTTGTAGGTTCCTGATAAGTTTCCATTTAAAAAATATTAGCTGTTTGACCAGGAGCACAATAAAAGCTATGCAATCAGATTGTATTTTTTAAGATTATACGAGATGGAAAAAATCACAACAATGGCAATCAGTGAGCAAAGGGAGATACATATACCCAAAAAACTGAAGTGATATTTTTAAGGAGAAGGTTAGAATGTGTGAATATAAAACCAAACGTTTACTGATGCTGCTAAAGAACATAACAGCAACAATAAGGTGATGTCTGCTGTTGTAACTCTTTAAAGCCACACACTTTGAGACTTGACTGACTTGTCTTGTGTTGGAGTTTGAGTTTTCTTGTGTTTTTCTGTAGAAATGTGGTTTTGACCAGCTGTACAAATGGCAGAGAGAGAAA[A/T]AGGCTAAGAAGGAGTACTGTCTTCATGATGGACCACCGTATGCCAATGGGGACCCTCATGTTGGGCATGCACTCAATAAGGTACCTCCTGTCACTTCGTCATCACACACATATGTAGATGTTCCTGGATCTACATCATCTAATTTTCTTCTCATACATTTTTGTCATTGTTATTTCAGTTAGCCTAAATGTAAACACAGAGATATGGGATTTTTCAAAAATATGCCATCAGCATCTACTGTTAATCTTTCCTGTAGATTCTCAAAGACATACGAAACCGTTTCGAGGTGCTGAGAGGCAGGCAGGTGCACTATGTGCCCGGCTGGGACTGTCATGGTCTGCCCATTGAACTCAAAGCGCTGGGAGACCTGGGAACCAATGAGCTGACTCCTGTCCAGATCAGACAGAAAGGTCAGGAGGTTGTGTATAAGCCATGTCCATCCAGAGCCTCATCCTTCTTTTTCATCCCTTCAATTTATGCTGAAAAGTTATTTAGTTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14246
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064803 Nonsense 181 983 4 23
ENSDART00000138853 Nonsense 181 886 4 21
Genomic Location (Zv9):
Chromosome 17 (position 25434762)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 25574681
GRCz11 17 25593072
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGGGCTGCTTTCCAGCGCTGGGGTGTGATGGCTGACTGGGACAACTGTTA[T/G]TACACTTTTGATGGGAAATATGAAGCAGCCCAGCTCAAGGTCTTCCAGGA
Long Flanking Sequence:
ACCTTGCCTGGCACTACTGTAAATTTATGAATTTTTACTAAAGTTTTTTTTGTCTTCAAATATTTCCGTTCCTCTGGCATTCGCTTACAATAAAAAAGAATCAGTTTAGCCTATGGGGGGTTGTTCTCAGCTTGCAACTTTTTTTGAAAGTGATCCTTGTCTAAAAACAAAAGAGGATTCACAGCTTGTAAAAAATTATGTTCTTTACAACAGCATCTGAAAAAGTTTATCTTTGAACCACTGTTTTGTTGCATTGTTAGATACTATTGACCTTTACTCCAAAATGATACTTGTTTTTAAAAGTGTAATCTGGCATTTTTGTTAACAAAAAGCTTAATCATACAAGTTTATTTAAAGTATGTGCTCCATATCTGATCTGACCAGTGATGAACTGTCTGTGTCTTTCTCCGTTCAGCTCGTGAGTTTGCAGAGAAGGCCATATCTCGACAGCGGGCTGCTTTCCAGCGCTGGGGTGTGATGGCTGACTGGGACAACTGTTA[T/G]TACACTTTTGATGGGAAATATGAAGCAGCCCAGCTCAAGGTCTTCCAGGAGATGCACAACAAGGTATTCATAAATGTTTCCTGTGCAACACAGCTTAGTATTAAAGGACTAAAGGAATTGTTCACAAAAGGATGAAAGTAAAAAAACGTTTTACATTTAGAAGCATGATACATTCCAGAATTCTTTGATAAAGAGAAACTTGATTTGAACGTTTTTTTCTTTAAAATGTAAATCTTTTTGTAACATTAAAGTCTCATCTATCAGTAAAAGTCATTTCAATTTAAATAAAGTAATAATTTAAAAACATTTAATAAGTTTAATAATAAAGTAATTCAATTAAATGTTAAAAAATATTTTAAAAATGTGATGTAAGTAATTTTTTTACCCTTTCTCATCTTAACATGTTGAAATGTGGTGCAAATGTCCTGATGTCCTTAAAAAGTTTCTCACTTTAGCTGTGTCTCTCTCTTTGAGTACAGGGTTTGATTTATCAAGACTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2910
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064803 Essential Splice Site 381 983 9 23
ENSDART00000138853 Essential Splice Site 381 886 9 21
Genomic Location (Zv9):
Chromosome 17 (position 25436412)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 25576331
GRCz11 17 25594722
KASP Assay ID:
554-2884.1 (used for ordering genotyping assays)
KASP Sequence:
CCCATGGCATGGATGACTACAGTGTCGCCACACACTTCAATCTACCAGTA[G/T]TATGTGACCCATACCTGTATATAACAACTAGGGATGCCAGATCGATTAAC
Long Flanking Sequence:
TGGGAGCAGAATCATACAAATTACGAGAGTTTTTTGGGGGAAATAACAAAGCGGGAGATGGGTGTGAAATGCAGGAGACTTCTAGAAAAATGTGAGTGTTGGCAGCCTGAAGTTAATGGTCATGTTTTTTCTTCTTCTTCAGGTATTCTGTAGTGAAGCGAGCTGATACTGAGCAGCTCCTGCTAGTGGCCACAGAGCGAATAAACAGCCTCTCCTCTTTACTGAAGACAAATCTGGAGAGTTTGGTCACATTTGCAGGTAGATCCAGTTTTATTGTTTAGAAAATGTTTATTAATCTGGCCTAAACCTCTCTCTTTCACTCATCTCCAGGGACAGATCTTGAAGGCGGAGTCTGTCAGCATCCCACAATTCCTTCAAAAGAAGTACCTTTGCTGCCAGCTAGTCATGTCACCATGACTAAGGGAACAGGATTGGTCCATACAGCTCCAGCCCATGGCATGGATGACTACAGTGTCGCCACACACTTCAATCTACCAGTA[G/T]TATGTGACCCATACCTGTATATAACAACTAGGGATGCCAGATCGATTAACTGAAGACTGATCAATCGATAATCTATTAGGTCTACTGTACATATCTTTAATGTGTAGTGCTTTTTTATTTTGTGTTAAATCGAATCATTAATTATCCTAAATGGACTGAAATATCACCTAACTCAGCTAGTGTATGTCATGGACATTTATGAGCAAATGTTCTCCAGATGTTCATTAATATAGTATACACAATATCCTAATCACAGTTGGAAAAATAAATATAACACTTACAATAACAAAGACAATTTGCTCACATTTACTATTGCTATATTTACTTTTTTTATATACCCTTATTACTATATGAACTATATTGCTATTGACATGTCTGGGTGTTATTATTTATTATTACTCAAGTCATTATGTAAATATATGTCATTGCATTTAGTCATTAGGTGGTTCAATTAAATGATCAATCGTTTATGTTTGCAATTCAACTAGCATTTCATTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17843
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064803 Nonsense 524 983 13 23
ENSDART00000138853 Nonsense 524 886 13 21
Genomic Location (Zv9):
Chromosome 17 (position 25438738)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 25578657
GRCz11 17 25597048
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAGCAAAACAARTCCCTGTTTCWCTYAGACATACAGTGACCCACATCGCT[A/T]AAGTTTTCTCTGAGAAGGGGAGCGACAGCTGGTGGACAGAGCCAGTGGAG
Long Flanking Sequence:
CAGGTCAAGGAGCAAGAAAGAGAGAGAGAGAGAGGGAGAGACAGAAAGAACACGTGCAAAAAATTGTGTTTGGTTCATAACTGGCATTTTCTTTTTCTTCTTTTAGTTAGTCATTCAAAAGTCTGGTACTTTGTGACTTTGTTCAATAAAACAGATTTTCTAATATGTTTCCAGTTAAATAAGAGCTTTTCTCCTCAAAATAATGTATGATTTTGTGTGTGTAGGATGCCCTGCAGAAAGTGCGTGTGATACCCGAATCTGCGAGGTCCAGTTTGTTGTCAATGTTGGACAGAAGAACATACTGGTGTATATCTCGACAGAGGAGCTGGGGCGTCCCTATCCCAGTGTTCTACCATAAAGAGACTGGAGAGCCACTCTTAAACAAGTAGATACACTTACACTGTTATTACATACACACTTAATCAACAGATTTAAAACATCTTAAAGTATAAGCAAAACAAGTCCCTGTTTCTCTCAGACATACAGTGACCCACATCGCT[A/T]AAGTTTTCTCTGAGAAGGGGAGCGACAGCTGGTGGACAGAGCCAGTGGAGACGTTTTTGACACCAGATGTTCTTCAGAAGGTACATTTTCATACACTACTTACAAACACAAAATAAAAACATCTTCTATTTCAATTTTCACTTTTGAATTTAAAAATGAAAAGCAAATAATGGCTTGTTTTTTGTATTTCAATATCCCTTTCTAAAAGAAAAATCCAATGACCAAAATATACACCGATGTATTATAAATAAAATTCTGGCTTCACACCAAACACAAAGAAAACAAGTGGATTGATTACTTACTCTAGATTACTCACAAAGAGTTTTTCATCTCACAAGAATTTTCTGCTCTGGTTGAACTTTTTTTGAAGATATGATTGAATCAAATTCTTTGTGTTTGCAGTAAACATTCCACACACATCATGTCATAGACTGTTGGAAATTCTCCTCTATTTGCACATTTGCATTGACTTTGGCCCAATCCCAATTCTATGCTTTAAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28863
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064803 Nonsense 600 983 15 23
ENSDART00000138853 Nonsense 600 886 15 21
Genomic Location (Zv9):
Chromosome 17 (position 25442091)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 25582010
GRCz11 17 25600401
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACCCGCGTGCAGACTCGTATGTCGAGGGGAAAGATCAGATCGGCGGCTG[G/A]TTTCAGTCGTCTCTCCTCACCAGTGTTGCTGTGCGGAATAAAGCTCCTTA
Long Flanking Sequence:
ATGTTTAAAAAAAACACAACATTGGCCTAATCGTGGAGACTTAAAAAACAAAAGTATTTATTTTTGCCCTCGAATGGCTGGTCGCATCTCAGATTGTTTTTAGTAGTTGGACTCTAGAGCCCTGCTGATTTGCTCTTCAATAAACATTTTTAATTGTTATCAATTTTGAAAACATTTGTTCAACTCAATTTATTAAATCAATTCTTTACTTGTTTGTCAGAGTAAAGCAAGTTCAGTGTCTGATTATGTGCGGGGTGAAGATGTCCTGGATATCTGGTTTGACAGTGGGGCTTCATGGGCCGCTGTACTGCCAGGTGAGTCGTCAAAAATTGCTTCCTTAAAATCTACATGAAATCTGGTTTCTCAAGAATTGTGTTATTTGCCTGTCTGCACTCCTCTGGTGTGTTTTTATTTTGTTGTTGTGTAATCTCACTCTCTCTTTCAGAATCAGACCCGCGTGCAGACTCGTATGTCGAGGGGAAAGATCAGATCGGCGGCTG[G/A]TTTCAGTCGTCTCTCCTCACCAGTGTTGCTGTGCGGAATAAAGCTCCTTACAAGTGAGTCATACAAATGCATCAGTTTGCCACAAATACACTTATCTAAATGGTTAGCCAACGTATTTAAGTTTTTTTTTCTTCAGAGCTCTAGTTGTTCATGGCTTTGCCGTGAGTGAGAAAGGAGAGAAAATGTCTAAGTCCATAGGCAACGTGGTGGACCCAGATGTGGTTATTAATGGGGGGAAGGTAAATATGATCAGTCTATGTCAGGGGTGGGCAAACTCGATCCTGGAGGGCCGGTGTCCTGCACAGTTTAGCTCCAACTCTAATCAAACACAACTGCTTATAGATTTCTAGTGATCTTAAAGACACTGATTAGTTTGTTCAGGTGTGTTTGACTAGTGTTTGAACAAAACTCTGCAGAGACACCGGCCCTCGAGGATCAAGTTTGCCCATTCCTGGTCTATGTTCTAGATTCATATTAGGTCATCTAGTCAGATCTTTGAA
Associated Phenotype:
Not determined