Busch Lab

ZMP

peli1

Ensembl ID:
ENSDARG00000044083
ZFIN ID:
ZDB-GENE-061027-372
Description:
protein pellino homolog 1 [Source:RefSeq peptide;Acc:NP_001071069]
Human Orthologue:
PELI3
Human Description:
pellino homolog 3 (Drosophila) [Source:HGNC Symbol;Acc:30010]
Mouse Orthologue:
Peli3
Mouse Description:
pellino 3 Gene [Source:MGI Symbol;Acc:MGI:1924963]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa18113 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa18113
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092948 Essential Splice Site None 425 2 7
ENSDART00000130161 None None 425 None 6
Genomic Location (Zv9):
Chromosome 17 (position 24321437)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 24474879
GRCz11 17 24493280
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GATCTGCCAGCTGATTGTGTCCTCACAGGTTTCTTTCTCTGTTCTGTGCA[G/A]TTGMAGTGACGATGAGGATGATGATGGTGATGAAGAGGAGACARAGTTGA
Long Flanking Sequence:
CATTGAGTGTGGGATTCCACATGACTACGGTCATTTTAATTCAGAATTAACAAAACTAAAAAGTAACTCACATTACATTTTTAAAAAGTAACTCAAATATTATTATTATTAAAAGTAATATTACATAACTCACGTAAGTTGTAACGTGTTACCCCCAACACTGCACGCGGTAATAAATTCAGATCATTTGATTTTAACAGTATTTAACAGTGAGTGTTTGGTTACTTTGACCGATTTTCCTAAGTGTTAAGCTTCATGGTTTGGTGTCTGCTTGAGCATTTGTTTGGGTTTAGGCGATCACCATCTTCTTAGTTTACTCTTTAGATCTTGTTAGCAGCCTTAATCTCATGCCTAAGCGCAAGTAAGACTGAAAAATATAGGCCACCCAACATCACCAAAGGATTTTTAAGTGGTGCCTGGTTTAATCCTGTCATTGAAAGTTACCTGAATGATCTGCCAGCTGATTGTGTCCTCACAGGTTTCTTTCTCTGTTCTGTGCA[G/A]TTGCAGTGACGATGAGGATGATGATGGTGATGAAGAGGAGACAGAGTTGAGAGCTGAGTGTGTGTGGTTGTGTTGCGTTCACACTGGGAGCGGGACGACCCCCCCTCCCCCACACACACTGCACCCATGTTCTCCCCCGACCAGGAAAACATCTCCACGTCGTCAACCAAAGTGCCAGTCAAATACGGAGAACTCATTGTGCTCGGGTAAGACCTTCTGACATTCGACCTCAGATCAGCAGAGAGCAGCATCTGTCGTGTTGGAGCTAATAGTTCGTAATGCTCTGTGACAACTCTTGCATGTGCGTGTTTGTGTGTTTCTGAAAATAGAGTCAGCTGCCATGAACTTTTTGTTTGTGGTTGTGGGCAAAATGTGAGGGTGATGCTTGTTGGCGGGAACAAAGGAGCCCTCAGTTGGAAAACAAAGCGGGTTTCAACGTGGTGTTAGAGGATCATAATGCACTTCATTGACTTGTATTTGCAAAACAGGCTCCTGTGTGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28856
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092948 Essential Splice Site 27 425 3 7
ENSDART00000130161 Essential Splice Site 27 425 2 6
Genomic Location (Zv9):
Chromosome 17 (position 24315667)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 24469109
GRCz11 17 24487510
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCTTTCAGCTGAATCTCTCTCTCTCTCTCTCTCTCTCTCTCTATCTGTA[G/T]GTATAATGGCTCTCTACCCAATGGGGACCGCGGCAGAAGGAAGAGCAGGT
Long Flanking Sequence:
TATTGTAGTAGACCACCTGTTTAAGAAATATTGTGAAGGATAATGATGTTGAAAATCTTGATGTTTAATTGAAGAGTTCTTCTATGTTGTTAAAAGAAATCAAGGCAAATTTCAAATGTAAAGACCCTTTTATTTTTATCACGAAAGATTATATTTGAAGTTATTAGTCTAGTAACTGTAGAAGCTGTTTTGGGGGTTGTGTCACCTCACCAGCATATATACATTTTATGAAGAGTGGATCTTGAAATGTATGGCATTTTGTGTTTTGGATTAGGTGTTGTTTCCAGTTAACAAACAAAATGATTGTTTGCTCTTCCAAGGAAAAGTATGGGATTGCATATCTACCGTACAGCTTTTGTTTGCTTGTGCTTTTGTGAGTGCATCTATCTGTTTTGTTCACCACCTGTTGCCTGCAGCTGAATTGGTGGTGAAGTATATGTTGCGCCCTGGTGCTTTCAGCTGAATCTCTCTCTCTCTCTCTCTCTCTCTCTCTATCTGTA[G/T]GTATAATGGCTCTCTACCCAATGGGGACCGCGGCAGAAGGAAGAGCAGGTTTGCACTCTTCAAAAGACCCAAATCCAATGGCGTCAAACCCAGCACTGTTCACGTAGCCTGCACCCCACAGGCAGCCAAGGTACCCTCCACCTAGGCATTACACAGGACTATCTTAAGAAAATCAGCAGTTACAGTGATATTTTGGTTCTGGGAGAGTTTTGAATAAAAAAAAAAAATAGGTAGGTTTGAGCTGCAATGGAACAGGGTGCGTCTGCTCGGACACATCTGGATACTGTTGAGCTCATGAATGACCCTTCTGTGGCTCCATCACAAACACACACATTTATACACAAACAGTTCCAGATTCCACAGCCTCTTAGACTCTATTGTGCTGGCCAATAAACTTTTGATGGAACTTTTTTCCACATCTGCAAATAGTGATCTGTGTTTATTTACACTTGTACACATTTACTTGCTTTAGTATATACAATGATATAATAATTATTGGT
Associated Phenotype:
Not determined