Busch Lab

ZMP

ctbp2

Ensembl ID:
ENSDARG00000044062
ZFIN IDs:
ZDB-GENE-010130-2, ZDB-GENE-010130-2, ZDB-GENE-010130-2
Description:
C-terminal-binding protein 2 isoform 1 [Source:RefSeq peptide;Acc:NP_001182420]
Human Orthologues:
AC011841.1, CTBP2
Human Descriptions:
C-terminal binding protein 2 [Source:HGNC Symbol;Acc:2495]
C-terminal binding protein 2 pseudogene (MGC70870), non-coding RNA [Source:RefSeq DNA;Acc:NR_003682]
Mouse Orthologue:
Ctbp2
Mouse Description:
C-terminal binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:1201686]

Alleles

There are 12 alleles of this gene:

Allele Name Consequence Status Availability
sa42871 Nonsense Mutation detected in F1 DNA Not yet available
sa42870 Nonsense Mutation detected in F1 DNA Not yet available
sa10746 Nonsense Available for shipment Available now
sa30695 Essential Splice Site, Missense Mutation detected in F1 DNA Not yet available
sa297 Nonsense F2 line generated Not yet available
sa32124 Nonsense Available for shipment Available now
sa32123 Nonsense Available for shipment Available now
sa17809 Nonsense Available for shipment Available now
sa23003 Nonsense Available for shipment Available now
sa32122 Nonsense Available for shipment Available now
sa12314 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa42871
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012546 Nonsense 42 710 1 9
ENSDART00000017337 Nonsense 42 1148 1 11
ENSDART00000049236 None None 405 None 11
Genomic Location (Zv9):
Chromosome 17 (position 8518633)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 8515975
GRCz11 17 8673155
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTGGGAGCGCAGTGACAGTGTTTACGAGCAGCAGGCCCGGATGGCTGGT[C/T]GACGCAACTCGCTGAGCTACGGAGCGGATGCAGGAGGGGGATGGTATGAA
Long Flanking Sequence:
CCATCTATTCACGCTTGTCGCTTTGCATTGCCACAATGGAGTAGTCAGGCAGGCTTCACCTACCTACCAGCGTTATTTGTGAGAGTGCATGGTGTCCTCTTTCCTGCTTCCATCACCACCAGCAGTATTCCCCAGATTAATTATTCAGCGATCACCAAGCGAGAGGAGCCATTTGATAGCCAGACCTTTCCACTGTGATAGAGACGGGACACAGAAATTACTACTGGACCTCAGGTGAAAAGCAATATCTTCTGTTTTGTATATCTTTTTTCGTTCACCCTCCTTCCTTACACCACTTGACATCAGCCTGCATCTAGAAATTTAAAGGAAAACATCTCTCACTTTTCTTCCCTGTGAGTAAGGTATATCTTTTCCTCATGTTGATCTCCAGTAAGCAGTTGCCGATCGGCCGATCCCAGAGCTGGGACACGCTGGGTGGGAATGAGGGTCATTGGGAGCGCAGTGACAGTGTTTACGAGCAGCAGGCCCGGATGGCTGGT[C/T]GACGCAACTCGCTGAGCTACGGAGCGGATGCAGGAGGGGGATGGTATGAACCAGCGCCTGGAGTGCGTCCTCCTGACCTCGATTTGAAACGGGAGCCAGAAGCCTACCAGGAATCTCTTTATAACCAAGGCTATTTGGATCGCCCGGACCCCCGTAACATAAGAAAGAGCTCCGTTCCTGAGTTGAACAGCCATTATGACCGACCACCAATAGCTCATCGTGGGACCATGCCACCCCATGACTATTATCAGCAAGACCCAGGCATGCCATCCCGGCCAACAGAGGGTTTCTATCGTGGCGAACAGCCTCATTCTCTGAATAGGTCATCTTCACATTATGGGATGATGGCAGGTCCTCGTCAGATTTGGGAGCAGGGCTCAGGAGGTCGTCCTGGTTCTGTTGCCCCAACACCTGGTGTACCTCCTCCCCCACCTCCAACTGTTCATGACATGGGTCGTATTTACCGAGACCCGATGCTGTCTGGACCCCTACCTGCAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42870
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012546 Nonsense 139 710 1 9
ENSDART00000017337 Nonsense 139 1148 1 11
ENSDART00000049236 None None 405 None 11
Genomic Location (Zv9):
Chromosome 17 (position 8518340)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 8515682
GRCz11 17 8672862
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATTATCAGCAAGACCCAGGCATGCCATCCCGGCCAACAGAGGGTTTCTA[T/A]CGTGGCGAACAGCCTCATTCTCTGAATAGGTCATCTTCACATTATGGGAT
Long Flanking Sequence:
CACTTGACATCAGCCTGCATCTAGAAATTTAAAGGAAAACATCTCTCACTTTTCTTCCCTGTGAGTAAGGTATATCTTTTCCTCATGTTGATCTCCAGTAAGCAGTTGCCGATCGGCCGATCCCAGAGCTGGGACACGCTGGGTGGGAATGAGGGTCATTGGGAGCGCAGTGACAGTGTTTACGAGCAGCAGGCCCGGATGGCTGGTCGACGCAACTCGCTGAGCTACGGAGCGGATGCAGGAGGGGGATGGTATGAACCAGCGCCTGGAGTGCGTCCTCCTGACCTCGATTTGAAACGGGAGCCAGAAGCCTACCAGGAATCTCTTTATAACCAAGGCTATTTGGATCGCCCGGACCCCCGTAACATAAGAAAGAGCTCCGTTCCTGAGTTGAACAGCCATTATGACCGACCACCAATAGCTCATCGTGGGACCATGCCACCCCATGACTATTATCAGCAAGACCCAGGCATGCCATCCCGGCCAACAGAGGGTTTCTA[T/A]CGTGGCGAACAGCCTCATTCTCTGAATAGGTCATCTTCACATTATGGGATGATGGCAGGTCCTCGTCAGATTTGGGAGCAGGGCTCAGGAGGTCGTCCTGGTTCTGTTGCCCCAACACCTGGTGTACCTCCTCCCCCACCTCCAACTGTTCATGACATGGGTCGTATTTACCGAGACCCGATGCTGTCTGGACCCCTACCTGCAACTCCTGGCACCAAAATGATGCATGAAGGACAGCGCATTCCAAGCAGAGCGCAATCTCCGGCTCGTTATATAATGGAGCCAAATTCTCCCCGTTACGCCGCTGAGCCTCCTGCCTCACTCACTAGCCATACAGTCTACAGTGATGTTAACGGAAGGCCAATTGATCCTCATCAGCCAACGGCCACATGCCTGGTGGTTGATCCAGTTGCTCAAGGAATGGATGGAACTTCCCGAGGTATGGTCATGCATCCGGAAAACCCCTCACCATACACCATACAGCAGCAACAGCAAGCCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10746
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012546 Nonsense 285 710 1 9
ENSDART00000017337 Nonsense 285 1148 1 11
ENSDART00000049236 None None 405 None 11
Genomic Location (Zv9):
Chromosome 17 (position 8517904)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 8515246
GRCz11 17 8672426
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCACATGCCTGGTGGTTGAWCCAGTTGCTCAAGGAATGGATGGAACTTCC[C/T]GAGGTATGGTCATGCATCCGGAAAACCCCTCACCATACACCATACAGCAG
Long Flanking Sequence:
TGCCACCCCATGACTATTATCAGCAAGACCCAGGCATGCCATCCCGGCCAACAGAGGGTTTCTATCGTGGCGAACAGCCTCATTCTCTGAATAGGTCATCTTCACATTATGGGATGATGGCAGGTCCTCGTCAGATTTGGGAGCAGGGCTCAGGAGGTCGTCCTGGTTCTGTTGCCCCAACACCTGGTGTACCTCCTCCCCCACCTCCAACTGTTCATGACATGGGTCGTATTTACCGAGACCCGATGCTGTCTGGACCCCTACCTGCAACTCCTGGCACCAAAATGATGCATGAAGGACAGCGCATTCCAAGCAGAGCGCAATCTCCGGCTCGTTATATAATGGAGCCAAATTCTCCCCGTTACGCCGCTGAGCCTCCTGCCTCACTCACTAGCCATACAGTCTACAGTGATGTTAACGGAAGGCCAATTGATCCTCATCAGCCAACGGCCACATGCCTGGTGGTTGATCCAGTTGCTCAAGGAATGGATGGAACTTCC[C/T]GAGGTATGGTCATGCATCCGGAAAACCCCTCACCATACACCATACAGCAGCAACAGCAAGCCCAACAGCAGCAACAAATGCAACAGCAAATACAACAGCAACAAATGCAGCAGGTTCAGCCAGTGCAACAAATGCAGCAGGTTCAGCCAGTGCAACAAATGCAGCAGGTTCAGCCAGTGCAACAAATGCAGCAAGCTCAGCCAGTGCAACAAATGCAGCAAGCTCAGCCAGTGCAACAGATGCAACCAGTTCAGCCAGTGCAGCAAATGCAACCAGTACAGCAAGTTCAGCAGGTACCACAAGTTCAGCCAGTGCAGCAAGTTCCACATGTGCAACCTGTGGCATCCCCAAATCCTATCTACACACCAGTTCCCCCTGTTGCCCCTGCCCCAGTTACCACTCCAGGTGTGGCCGTTATTCCTGCTCCATTACCTCAGCTTCCTGCTCAGCCTCTCACTGCTGCTCCTCCTCCTTCTGTCCCTCAGACCCCAGTGGCTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30695
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site, Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012546 Essential Splice Site 285 710 1 9
ENSDART00000017337 Missense 286 1148 1 11
ENSDART00000049236 None None 405 None 11
Genomic Location (Zv9):
Chromosome 17 (position 8517900)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 8515242
GRCz11 17 8672422
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGCCTGGTGGTTGATCCAGTTGCTCAAGGAATGGATGGAACTTCCCGAG[G/A]TATGGTCATGCATCCGGAAAACCCCTCACCATACACCATACAGCAGCAAC
Long Flanking Sequence:
ACCCCATGACTATTATCAGCAAGACCCAGGCATGCCATCCCGGCCAACAGAGGGTTTCTATCGTGGCGAACAGCCTCATTCTCTGAATAGGTCATCTTCACATTATGGGATGATGGCAGGTCCTCGTCAGATTTGGGAGCAGGGCTCAGGAGGTCGTCCTGGTTCTGTTGCCCCAACACCTGGTGTACCTCCTCCCCCACCTCCAACTGTTCATGACATGGGTCGTATTTACCGAGACCCGATGCTGTCTGGACCCCTACCTGCAACTCCTGGCACCAAAATGATGCATGAAGGACAGCGCATTCCAAGCAGAGCGCAATCTCCGGCTCGTTATATAATGGAGCCAAATTCTCCCCGTTACGCCGCTGAGCCTCCTGCCTCACTCACTAGCCATACAGTCTACAGTGATGTTAACGGAAGGCCAATTGATCCTCATCAGCCAACGGCCACATGCCTGGTGGTTGATCCAGTTGCTCAAGGAATGGATGGAACTTCCCGAG[G/A]TATGGTCATGCATCCGGAAAACCCCTCACCATACACCATACAGCAGCAACAGCAAGCCCAACAGCAGCAACAAATGCAACAGCAAATACAACAGCAACAAATGCAGCAGGTTCAGCCAGTGCAACAAATGCAGCAGGTTCAGCCAGTGCAACAAATGCAGCAGGTTCAGCCAGTGCAACAAATGCAGCAAGCTCAGCCAGTGCAACAAATGCAGCAAGCTCAGCCAGTGCAACAGATGCAACCAGTTCAGCCAGTGCAGCAAATGCAACCAGTACAGCAAGTTCAGCAGGTACCACAAGTTCAGCCAGTGCAGCAAGTTCCACATGTGCAACCTGTGGCATCCCCAAATCCTATCTACACACCAGTTCCCCCTGTTGCCCCTGCCCCAGTTACCACTCCAGGTGTGGCCGTTATTCCTGCTCCATTACCTCAGCTTCCTGCTCAGCCTCTCACTGCTGCTCCTCCTCCTTCTGTCCCTCAGACCCCAGTGGCTCCTGTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa297
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012546 None None 710 None 9
ENSDART00000017337 Nonsense 310 1148 1 11
ENSDART00000049236 None None 405 None 11
Genomic Location (Zv9):
Chromosome 17 (position 8517829)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 8515171
GRCz11 17 8672351
KASP Assay ID:
554-3044.1 (used for ordering genotyping assays)
KASP Sequence:
ACCCCTCACCATACACCATACAGCAGCAACAGCAAGCCCAACAGCAGCAA[C/T]AAATGCAACAGCAAATACAACAGCAACAAATGCAGCAGGTTCAGCCAGTG
Long Flanking Sequence:
AGCCTCATTCTCTGAATAGGTCATCTTCACATTATGGGATGATGGCAGGTCCTCGTCAGATTTGGGAGCAGGGCTCAGGAGGTCGTCCTGGTTCTGTTGCCCCAACACCTGGTGTACCTCCTCCCCCACCTCCAACTGTTCATGACATGGGTCGTATTTACCGAGACCCGATGCTGTCTGGACCCCTACCTGCAACTCCTGGCACCAAAATGATGCATGAAGGACAGCGCATTCCAAGCAGAGCGCAATCTCCGGCTCGTTATATAATGGAGCCAAATTCTCCCCGTTACGCCGCTGAGCCTCCTGCCTCACTCACTAGCCATACAGTCTACAGTGATGTTAACGGAAGGCCAATTGATCCTCATCAGCCAACGGCCACATGCCTGGTGGTTGATCCAGTTGCTCAAGGAATGGATGGAACTTCCCGAGGTATGGTCATGCATCCGGAAAACCCCTCACCATACACCATACAGCAGCAACAGCAAGCCCAACAGCAGCAA[C/T]AAATGCAACAGCAAATACAACAGCAACAAATGCAGCAGGTTCAGCCAGTGCAACAAATGCAGCAGGTTCAGCCAGTGCAACAAATGCAGCAGGTTCAGCCAGTGCAACAAATGCAGCAAGCTCAGCCAGTGCAACAAATGCAGCAAGCTCAGCCAGTGCAACAGATGCAACCAGTTCAGCCAGTGCAGCAAATGCAACCAGTACAGCAAGTTCAGCAGGTACCACAAGTTCAGCCAGTGCAGCAAGTTCCACATGTGCAACCTGTGGCATCCCCAAATCCTATCTACACACCAGTTCCCCCTGTTGCCCCTGCCCCAGTTACCACTCCAGGTGTGGCCGTTATTCCTGCTCCATTACCTCAGCTTCCTGCTCAGCCTCTCACTGCTGCTCCTCCTCCTTCTGTCCCTCAGACCCCAGTGGCTCCTGTAGACCCTAAAAAAAATGCAGACCCTGAGTTTCTGGCATTGTTGCATAAAGAGGGCCTCTCGGAAAGCACCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32124
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012546 None None 710 None 9
ENSDART00000017337 Nonsense 328 1148 2 11
ENSDART00000049236 None None 405 None 11
Genomic Location (Zv9):
Chromosome 17 (position 8517748)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 8515090
GRCz11 17 8672270
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCAGCAGGTTCAGCCAGTGCAACAAATGCAGCAGGTTCAGCCAGTGCAA[C/T]AAATGCAGCAGGTTCAGCCAGTGCAACAAATGCAGCAAGCTCAGCCAGTG
Long Flanking Sequence:
GTCGTCCTGGTTCTGTTGCCCCAACACCTGGTGTACCTCCTCCCCCACCTCCAACTGTTCATGACATGGGTCGTATTTACCGAGACCCGATGCTGTCTGGACCCCTACCTGCAACTCCTGGCACCAAAATGATGCATGAAGGACAGCGCATTCCAAGCAGAGCGCAATCTCCGGCTCGTTATATAATGGAGCCAAATTCTCCCCGTTACGCCGCTGAGCCTCCTGCCTCACTCACTAGCCATACAGTCTACAGTGATGTTAACGGAAGGCCAATTGATCCTCATCAGCCAACGGCCACATGCCTGGTGGTTGATCCAGTTGCTCAAGGAATGGATGGAACTTCCCGAGGTATGGTCATGCATCCGGAAAACCCCTCACCATACACCATACAGCAGCAACAGCAAGCCCAACAGCAGCAACAAATGCAACAGCAAATACAACAGCAACAAATGCAGCAGGTTCAGCCAGTGCAACAAATGCAGCAGGTTCAGCCAGTGCAA[C/T]AAATGCAGCAGGTTCAGCCAGTGCAACAAATGCAGCAAGCTCAGCCAGTGCAACAAATGCAGCAAGCTCAGCCAGTGCAACAGATGCAACCAGTTCAGCCAGTGCAGCAAATGCAACCAGTACAGCAAGTTCAGCAGGTACCACAAGTTCAGCCAGTGCAGCAAGTTCCACATGTGCAACCTGTGGCATCCCCAAATCCTATCTACACACCAGTTCCCCCTGTTGCCCCTGCCCCAGTTACCACTCCAGGTGTGGCCGTTATTCCTGCTCCATTACCTCAGCTTCCTGCTCAGCCTCTCACTGCTGCTCCTCCTCCTTCTGTCCCTCAGACCCCAGTGGCTCCTGTAGACCCTAAAAAAAATGCAGACCCTGAGTTTCTGGCATTGTTGCATAAAGAGGGCCTCTCGGAAAGCACCATCAATTCTCTACTGCAGCAGGGCTTTGACTCCACTGCAATGTTGGCCGTTATGGAGGAAAATGATGTGCGTTCAGTTGCCCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32123
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012546 None None 710 None 9
ENSDART00000017337 Nonsense 337 1148 2 11
ENSDART00000049236 None None 405 None 11
Genomic Location (Zv9):
Chromosome 17 (position 8517721)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 8515063
GRCz11 17 8672243
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCAGCAGGTTCAGCCAGTGCAACAAATGCAGCAGGTTCAGCCAGTGCAA[C/T]AAATGCAGCAAGCTCAGCCAGTGCAACAAATGCAGCAAGCTCAGCCAGTG
Long Flanking Sequence:
CTGGTGTACCTCCTCCCCCACCTCCAACTGTTCATGACATGGGTCGTATTTACCGAGACCCGATGCTGTCTGGACCCCTACCTGCAACTCCTGGCACCAAAATGATGCATGAAGGACAGCGCATTCCAAGCAGAGCGCAATCTCCGGCTCGTTATATAATGGAGCCAAATTCTCCCCGTTACGCCGCTGAGCCTCCTGCCTCACTCACTAGCCATACAGTCTACAGTGATGTTAACGGAAGGCCAATTGATCCTCATCAGCCAACGGCCACATGCCTGGTGGTTGATCCAGTTGCTCAAGGAATGGATGGAACTTCCCGAGGTATGGTCATGCATCCGGAAAACCCCTCACCATACACCATACAGCAGCAACAGCAAGCCCAACAGCAGCAACAAATGCAACAGCAAATACAACAGCAACAAATGCAGCAGGTTCAGCCAGTGCAACAAATGCAGCAGGTTCAGCCAGTGCAACAAATGCAGCAGGTTCAGCCAGTGCAA[C/T]AAATGCAGCAAGCTCAGCCAGTGCAACAAATGCAGCAAGCTCAGCCAGTGCAACAGATGCAACCAGTTCAGCCAGTGCAGCAAATGCAACCAGTACAGCAAGTTCAGCAGGTACCACAAGTTCAGCCAGTGCAGCAAGTTCCACATGTGCAACCTGTGGCATCCCCAAATCCTATCTACACACCAGTTCCCCCTGTTGCCCCTGCCCCAGTTACCACTCCAGGTGTGGCCGTTATTCCTGCTCCATTACCTCAGCTTCCTGCTCAGCCTCTCACTGCTGCTCCTCCTCCTTCTGTCCCTCAGACCCCAGTGGCTCCTGTAGACCCTAAAAAAAATGCAGACCCTGAGTTTCTGGCATTGTTGCATAAAGAGGGCCTCTCGGAAAGCACCATCAATTCTCTACTGCAGCAGGGCTTTGACTCCACTGCAATGTTGGCCGTTATGGAGGAAAATGATGTGCGTTCAGTTGCCCCCAACTTGGGCCAAGCCAGGGTTCTCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17809
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012546 None None 710 None 9
ENSDART00000017337 Nonsense 593 1148 2 11
ENSDART00000049236 None None 405 None 11
Genomic Location (Zv9):
Chromosome 17 (position 8516951)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 8514293
GRCz11 17 8671473
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGCAGACCCAGCAGTGCWCCCTCCCAGCAGCTTCTTGAGACCAGTKGGTA[T/A]SCTGGACCYAGGGTTTCCGGGGTATACAGTRGTGCTATGGTTCCTGTCCA
Long Flanking Sequence:
CTCACTGCTGCTCCTCCTCCTTCTGTCCCTCAGACCCCAGTGGCTCCTGTAGACCCTAAAAAAAATGCAGACCCTGAGTTTCTGGCATTGTTGCATAAAGAGGGCCTCTCGGAAAGCACCATCAATTCTCTACTGCAGCAGGGCTTTGACTCCACTGCAATGTTGGCCGTTATGGAGGAAAATGATGTGCGTTCAGTTGCCCCCAACTTGGGCCAAGCCAGGGTTCTCTCTCGTGTTGTGCTTTGCTGCAAACGACCACCTGAAATTGTACCTGCTACCCCCCTGCATCCCAGCGCTCCAGCCCGCGGCAGATCCAACAGCTTCAGCCATCGCAGTGACATCTACGTGCACCAGCCACCACCCTTGACTCCAGGCTTGGAGTCGCAGTATATCCAGCCACCCTCTACCCCCATGCAGACTATGTCTCCGAGAATTGGTGATGGCTACAGTCGCAGACCCAGCAGTGCTCCCTCCCAGCAGCTTCTTGAGACCAGTGGGTA[T/A]CCTGGACCCAGGGTTTCCGGGGTATACAGTGGTGCTATGGTTCCTGTCCAACCTCGACCATTGTCAGGTTACAATCCACATTCTGGATTACCTGTGACTGCAATGTCCCAACAGGTTGCCATTCCAGCACATTTACCAGGAATACAACAACAAATGGCAGCTTTGCCACCCCAAATTCATGCAATGCCATTGCCAGCTCTATCTGCAGTTCCCCAGTCAATGACTGTACCTGCTTTGGCACCCCAGCAAGCCCCGAAAGCATACACCACCAACTATACCGTACCAATGGAGTTAATGAAGAGGGATCGAAGCTTGGCTACAATGTCACCCATGCCCAGTCCCCATTTAAGCCCACAAGTAATGCGCAAAGCTGGAGTGTCCTCAGATGGAGCCCTAGTACCCATTGGAGGTGCCGTTCCAGGCCAAAATATGAACCTGGCTAATCAGAAGCTGAGCCGGCGTACTGGACCTCCGGTCATTGTCTCCACTATGGCATCACC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28809
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012546 Essential Splice Site 385 710 3 9
ENSDART00000017337 Essential Splice Site 862 1148 4 11
ENSDART00000049236 Essential Splice Site 119 405 4 11
Genomic Location (Zv9):
Chromosome 17 (position 8471410)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 8468752
GRCz11 17 8625932
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATCGGCAGTGGATACGACAACATCGACATTAAAGCTGCCGGAGAGATGG[G/T]TGAGAGAGCCTGTTTATACTCACAATAGAGGCATTTGTACAATACAGTAA
Long Flanking Sequence:
AAAAATAGAAGAAAGAGAACAAAAGAAAGAAAGAAGCATATATTTTTACAGAGACAGGCGTCATTCTTGTTTTATTGAGCCACATATCAGAGCCACTGATGCAGAAACTGTTGGACTATCAGCTCAAAATCAGGGTGTTTGCCTGTTCAGTTTATCCTTGTTTTATGGATGGTTCAGTCTAAATGAGGGCTTTGACTTTGTAGTGTTTGTAAAGCAAACATTTCTCAGTTCTCAAACTGAAAGGAAATGTACGGACATGGCAAACTCCTCAAGACAAATGCATTACACCCACATGCTCTACAGAGAAATGATGTGCGTGTCTGTGATGCTCATGATCATGTGTCTGCGTGTGCAGGTGTTGAACGAGGCGGTGGGTGCGATGATGTACCACACCATCACCCTGACCAGAGAAGACCTGGAAAAGTTCAAAGCCCTCCGGATTATCATCCGCATCGGCAGTGGATACGACAACATCGACATTAAAGCTGCCGGAGAGATGG[G/T]TGAGAGAGCCTGTTTATACTCACAATAGAGGCATTTGTACAATACAGTAAACATTTGAAAGAGTTTTGAAGAAGAAAAGATTTTCGCGATAATTGCAAGATGAAAAGGGTTTCTATGTTTGATATTAAATTCATTCGAGATGCACCAGTAGTATTTTGAATTTATATTATGTATATTGGTCAATTGCATATAGTATTATACACCCATCGGCCACTTTATTAGGTACACCTGTCCAACTGCTCGTTAACACAAGTTTCAAATCAGCCAATCACATGGCAGCAACTCAATGCATTTAGGCATGTAGTCGTGGTCTAGACGATCTGCTGCAGTTCAAACCGAGCCTCAGAATGGGGAAGAAAGGGGATTTAAGAGACTTTGAACGTGGCATGATTGTTGGTGCCAGACGGGCTGGTCTGAGTATTTCAGAAACTGCTGATCTACTGGGATTTTCACGTCCAACCATCTCTAGGGTTTACAGAGAATGGCTTGAAGAAGAGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23003
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012546 Nonsense 475 710 5 9
ENSDART00000017337 Nonsense 952 1148 6 11
ENSDART00000049236 Nonsense 209 405 6 11
Genomic Location (Zv9):
Chromosome 17 (position 8466467)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 8463809
GRCz11 17 8620989
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGGCAGTGGCAGTTCGAGCGAAAGCGTTTGGCTTTAATGTGATCTTTTA[C/A]GACCCGTATCTGCAAGACGGATTAGAGCGATCGCTGGGCGTGCAGAGAGT
Long Flanking Sequence:
GAAGTTGAAGGCCTCGTGTGACAGGAAGTAAATAAATTCCTTTTTTTCTTTCTTGAAATCTTTGATCTGGTTGTTAACTTGCATGTCATTGAGAAATTAAACATGTATAACATTTAGAAAATTTCTCATTAAAGGAAAATGGGAACTATGAACTTTGACAACTGTACAGTAGTTGCCAGTGGGATTACCTGTATCTTAATATTGTAATGTAAAAAAATAATATGTTGAAAATGCATCCCTCTTAACAAGACTACAATAATTTCAATAATTTAAAAAACAAACTTTTGACTGATATAAAGATATGCAGAAATACTAATCAAATTATGCCACCAATTGTGTCGTCATGCAGTCCGGACGACATATAAATATTATATTTGTTTTCATATAACTTTTTAAGTTTGATTTTGTGCTCATATATGCCTCTAACTGTCTCCTGTAGGTCGATCGGGGCAGGCAGTGGCAGTTCGAGCGAAAGCGTTTGGCTTTAATGTGATCTTTTA[C/A]GACCCGTATCTGCAAGACGGATTAGAGCGATCGCTGGGCGTGCAGAGAGTTTACACCTTACAGGACCTGCTGTACCAGAGCGACTGTGTGTCTCTGCACTGCAACCTGAACGAACACAACCATCACCTCATCAACGACTTCACCATCAAACAGGTAAATAATGCTGGCCACAGCGCCGTCTAGTGTCTGCAAAGACCCCTGCGCATCCTTAAAGGAATAGTTCACACAAAAGTTCTTGTGTTTGCAAATTTCCGTGCACATTTTTAAAGGGATAGTTCACCCAATAATATTCTACACCTAACATTAATATACAGTAATGTCCATTCTGTTCTTTACTATTATTCTTAAAAGGATAGTTCACCCAAAACTAGGGATGGGTATCGTTTGGGGTTATTTCATTACCTGTGCTAATTCAATATTTTTAAATGGTATCAGTGCCAAAACGGTGCCTGAACTAATACTTTTAAGCCACAAAATGATGGTGGATGACTCTAGAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32122
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012546 Nonsense 609 710 7 9
ENSDART00000017337 Nonsense 1086 1148 8 11
ENSDART00000049236 Nonsense 343 405 8 11
Genomic Location (Zv9):
Chromosome 17 (position 8457048)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 8454390
GRCz11 17 8611570
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGAGCAGGCCTCACTAGAGATGAGAGAGGCAGCAGCCACCGAGATCCGC[A/T]GAGCCATCACCGGTACAACATCTCACTGCATTTATTACACACTGCTCACC
Long Flanking Sequence:
ATAAATACATGTATTTACTGTGTACTTATGCTTGATTAAATACATGTATGTCATTACATCTGTTATTAACTTTTGTAATAACATTTGTAAATACACTGTTGACCACCCCTTACACCTTAAACCTTCCCTTAAACCTACCCATACCACCAAACCTGTCCATAACCAAACCTCTATTCCAACTCCAAAGCACCATGTGTTCTCAAATACATTATAAAAACAGTAAGTACATTGTATTTATTTTTTTATGTAAGTACATAGTACTTAAGGACACTTAATAAAAAGTGGGACCATTTTATTTTAGTAATTTATGCAATTTCTTCAAAGTATGTGTCATGATCATCCTGCAGTCTTATTCTGTCTGCCTCATGCTGTGTTTTTCTCTCAGTTTCACTCAGGGTCCTCTGAAGGACGCGCCCAATCTGATCTGCACCCCTCACACAGCCTGGTACAGTGAGCAGGCCTCACTAGAGATGAGAGAGGCAGCAGCCACCGAGATCCGC[A/T]GAGCCATCACCGGTACAACATCTCACTGCATTTATTACACACTGCTCACCTTGCATTACATATGTGTTTTGTTGATCCGATTACTGGAGAATGATGCTAAATACAGACTTAAATGGGTGTAAGCTAGTTCACTTCATCCATTCAATAATTTTCCTTTGGCTTAGTCCCTTATTTATAAGGGACCCAGAGCGGAATGAACCACCAACTATTCAAATCAAAACGCTCATGTTCTCTATCGCGTTTAGTGTTGGTCAAGTGTGGTAGCATCTTTTAATTAGGAAAAAAATATTTTATTTTATTATTTTTTTTTTTTATTTTGCTCTTTTATTGACAATCTTTTATTGACAAACTATTCCAGCATATGCTTTACACAGCAGATACCCTTCCAGCTGCAACACAGTACTGGAAACATGGTCTTTCGCATTCACATACTCTACAGCCAGTTTAGTTAATCCAATTCACCTACAGCACATGTGTTACGTCATTTTAGATGTTAATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12314
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012546 None None 710 None 9
ENSDART00000017337 Nonsense 1147 1148 10 11
ENSDART00000049236 Nonsense 404 405 10 11
Genomic Location (Zv9):
Chromosome 17 (position 8449614)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 8446956
GRCz11 17 8604136
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCCCAGCCGCTCCCAGCCGTCTCTCCCGGCGGCCTGCAAGACAAAATGTA[T/A]ACCTAAACAATGACAGGTAAATAKTGCTNAAAGTCCCCGAAGAGAWCAAG
Long Flanking Sequence:
ATGAATAAGTACTAAAGGCAAGTTTCAGGTCTGTAAAGTCTAAGGGAAGTGTTAGTAGTTTTTTAGTTTTTTTTAGTTAGTAGTTTTTTTTTATTTAAAGTGTCAGAGCGATAAAAGAGAGTGTTTTCTACCCACTCACATGTGTGAGGAATACTATCGAAAACTACTCTAATAAACTACTAAATATCTAAAAAATAAATTGAAAGTTCAACTCAACTAAAACTAAACAAGCTAAACAAACTAAAGCTAATCTGAAATGGCGAATTTAAAAATAGTATCAAAATAAAAACTAACAAAAACTTGCGAAACTGTTATAACTTTGGTATCACCCGCTGTGACCCTTCTGAACGCCTCCCCAAACTAACCCCTCATTTAAATGCATGAACTCTCCAAACCACACATGCAAACAGAGCTTTCTCAGTCTGACTGCTTCTCTCGCTCAGCAGAGTCGCCCAGCCGCTCCCAGCCGTCTCTCCCGGCGGCCTGCAAGACAAAATGTA[T/A]ACCTAAACAATGACAGGTAAATATTGCTGAAAGTCCCCGAAGAGATCAAGACACTGTGGAGATGATTTTGATTATGAAGCCTTGAACAGTGGCATCTGAAACAGGATTTCACTTTGATTTTCACTTTGATTTTCTGATGATTTCACTTTGATTTTAAACATTTCTCATTTTCATGTGCTCAATATGACATGCTGTGATGTGAAATCTGAGGATTTATGGAAATGTTACATTAGGGCTGTTGTTTTTAGTTTATTATTATTATTATTATTATTATTATTATTATTATTATTAAATTCAAAATTATTAGCCCTCCTGTGATTTATTTATTTTTTTTTATAAATCACAAGTGATGTTTAACAGAGCAAGGCAAGGAATTTTTCATTATATTATATTATTCTATATTAAATTATTATATTATATTATATTATATTATATTATATTATATTATATTATATTATATTATATTATATTATGTTATATTATGTTATGTTATATTATGT
Associated Phenotype:
Not determined