Busch Lab

ZMP

rassf2l

Ensembl ID:
ENSDARG00000044044
ZFIN ID:
ZDB-GENE-041221-6
Description:
Ras association (RalGDS/AF-6) domain family 2, like [Source:RefSeq peptide;Acc:NP_001002195]
Human Orthologue:
RASSF2
Human Description:
Ras association (RalGDS/AF-6) domain family member 2 [Source:HGNC Symbol;Acc:9883]
Mouse Orthologue:
Rassf2
Mouse Description:
Ras association (RalGDS/AF-6) domain family member 2 Gene [Source:MGI Symbol;Acc:MGI:2442060]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa8593 Nonsense Mutation detected in F1 DNA Not yet available
sa10991 Essential Splice Site Available for shipment Available now
sa34887 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa8593
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064662 Nonsense 41 316 3 10
ENSDART00000142028 Nonsense 41 312 3 10
Genomic Location (Zv9):
Chromosome 10 (position 20726307)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 20687721
GRCz11 10 20645102
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CACATCTCAAAACATATAACGTGTATTTTGAAGGAGATGCCCTTCAGTTG[A/T]GWCACAGAGAGRTTGGTTATTTGGCAAGCTAYAGTCTRTTGTTTTGATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10991
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064662 Essential Splice Site 44 316 3 10
ENSDART00000142028 Essential Splice Site 44 312 3 10
Genomic Location (Zv9):
Chromosome 10 (position 20726295)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 20687709
GRCz11 10 20645090
KASP Assay ID:
2260-3149.1 (used for ordering genotyping assays)
KASP Sequence:
CATATAACGTGTATTTTGAAGGAGATGCCCTTCAGTTGWGWCACAGAGAG[G/A]TTGGTTATTTGGCAAGCTAYAGTCTRTTGTTTTGATGTGTTACACCACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34887
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064662 Essential Splice Site 223 316 8 10
ENSDART00000142028 Essential Splice Site 219 312 8 10
Genomic Location (Zv9):
Chromosome 10 (position 20724183)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 20685597
GRCz11 10 20642978
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGGTTTTCTTTTGTTTGTGCAAGATAGTTCATTTTCATTTTGTCATTTA[G/A]AGAGGCATCAGCTGAAGCCCAATGATCATCCTTTGCTGGTTAGAGTTTTG
Associated Phenotype:
Not determined