Busch Lab

ZMP

si:busm1-189a20.4

Ensembl ID:
ENSDARG00000043973
ZFIN ID:
ZDB-GENE-030131-9559
Description:
zinc finger protein 292 [Source:RefSeq peptide;Acc:NP_001025383]
Human Orthologue:
ZNF292
Human Description:
zinc finger protein 292 [Source:HGNC Symbol;Acc:18410]
Mouse Orthologue:
Zfp292
Mouse Description:
zinc finger protein 292 Gene [Source:MGI Symbol;Acc:MGI:1353423]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa23613 Nonsense Available for shipment Available now
sa23612 Nonsense Available for shipment Available now
sa12684 Nonsense Available for shipment Available now
sa1811 Missense F2 line generated Not yet available
sa18668 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29284
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104790 Nonsense 8 2620 1 8
Genomic Location (Zv9):
Chromosome 20 (position 232629)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 223224
GRCz11 20 211859
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGCGTACGCGGCGGAATTGTAAGTGAAGATGGCGGACGAGGAGGCCGAG[C/T]AGGAGCGCAGCGCGCGGAGCGACACTTCCAGCGCGTTGCAGGCGCTCGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23613
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104790 Nonsense 124 2620 3 8
Genomic Location (Zv9):
Chromosome 20 (position 228063)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 218658
GRCz11 20 207293
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTGCAGAGCTGCTGCTTTCTCTGCCGCGGAATATCCCAGATGCATTGTG[G/A]GACAGGTTTAGGACATCCGTCCAGGTACATTTAGCAGGCTGTCTCTATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23612
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104790 Nonsense 333 2620 7 8
Genomic Location (Zv9):
Chromosome 20 (position 225037)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 215632
GRCz11 20 204267
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCAGATGTCGTTCCTGTCTAAAACTGTGTTCCACCTACTCTTCTTCATT[A/T]AATTCATCCAAACAGAGGTGAGCTGTGCCTGTTCACACTTACAGCTGTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12684
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104790 Nonsense 1030 2620 8 8
Genomic Location (Zv9):
Chromosome 20 (position 222594)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 213189
GRCz11 20 201824
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCTCGTCTCACTGGGTCAGATGCTTCCYCCCGTTTCTCAGACACTTCCTT[T/A]GCAAATGGCTTCCGTACCAAACGAKGGACAAGTTTTGGAAAACAAATGTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4875
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104790 Nonsense 1707 2620 8 8
Genomic Location (Zv9):
Chromosome 20 (position 220564)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 211159
GRCz11 20 199794
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGCAGCAACCTAATGTAAACGCATCTGACGTCCTTGTTGAGACTGTTTCA[C/T]AAATGAGCCCAAACGATGGCTTAAATCACACCATGTCATCTGTGCTACCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1811
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104790 Missense 2209 2620 8 8
Genomic Location (Zv9):
Chromosome 20 (position 219058)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 209653
GRCz11 20 198288
KASP Assay ID:
554-1803.1 (used for ordering genotyping assays)
KASP Sequence:
GTTTCTGGAAGTACATCCGCCACGTTGACAAAAAGCATAAAGAAACCCAG[C/T]TCTCAAAGGTTAACGCTGTGGCGGGGGTGTTCAGATGTCCGATGGAAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18668
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104790 Nonsense 2349 2620 8 8
Genomic Location (Zv9):
Chromosome 20 (position 218636)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 209231
GRCz11 20 197866
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAGGGTTGTGAAACGGTGACGAGTTCAGAGMGAAATATAATGAAGCATTA[T/A]CTWCAGCATGGCCTCCCAAAACARYAYTYGRAAGAACAGAGAAGCAACTT
Associated Phenotype:
Not determined