Busch Lab

ZMP

ENSDARG00000043953

Ensembl ID:
ENSDARG00000043953
Human Orthologues:
PCDHB1, PCDHG@, PCDHGA1, PCDHGA10, PCDHGA11, PCDHGA12, PCDHGA3, PCDHGA5, PCDHGA6, PCDHGA7, PCDHGA8
Human Descriptions:
protocadherin beta 1 [Source:HGNC Symbol;Acc:8680]
protocadherin gamma cluster [Source:HGNC Symbol;Acc:8695]
protocadherin gamma subfamily A, 1 [Source:HGNC Symbol;Acc:8696]
protocadherin gamma subfamily A, 10 [Source:HGNC Symbol;Acc:8697]
protocadherin gamma subfamily A, 11 [Source:HGNC Symbol;Acc:8698]
protocadherin gamma subfamily A, 12 [Source:HGNC Symbol;Acc:8699]
protocadherin gamma subfamily A, 3 [Source:HGNC Symbol;Acc:8701]
protocadherin gamma subfamily A, 5 [Source:HGNC Symbol;Acc:8703]
protocadherin gamma subfamily A, 6 [Source:HGNC Symbol;Acc:8704]
protocadherin gamma subfamily A, 7 [Source:HGNC Symbol;Acc:8705]
protocadherin gamma subfamily A, 8 [Source:HGNC Symbol;Acc:8706]
Mouse Orthologue:
Pcdhb1
Mouse Description:
protocadherin beta 1 Gene [Source:MGI Symbol;Acc:MGI:2136730]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa21719 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27595
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025258 Nonsense 216 818 1 1
Genomic Location (Zv9):
Chromosome 10 (position 21760779)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 21727454
GRCz11 10 21684835
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAAGTGGGGTTAAATGTGCTGAAATGGTGCTTCAGAAACCTCTAGACAGA[G/T]AACAACAGCCATTGCTTTCTCTTATTGTCACAGCAGTCGATGGAGGAAAC
Long Flanking Sequence:
CAGAGGAAATGAAGAAAGGATCTCTTATCGGGAATATAGCTCATGATCTTGGTCTGGATGTTCAAAGACTGCGCTCGGGTCGAGCTCGTATCGTGTCTGGCGACAGCACCGAGTATGTAGAGCTCAAAACAGACAAAGGGATTTTGGTTGTAAAGGACAGAATTGACCGAGAGCAGCTTTGCGCTGAAACCACTCCGTGCAGCTTCACGTTTGAAATAATACTCGATAATCCAATGGAGCTACATCATGTTACGGTGGAAATATTGGATGTGAACGATCATTCGCCAGTTTTTCCTAAAGATGAAATTTATCTTGAAATAAGCGAATCGGCCGCCCCCGGTGCTCGTTTTTTATTGGGAAGCGCAGATGATCCTGATGTGGGTATGAATAGTATACAAAAGTATGTCATATCACAGAATGATAATTTCGTTTTGAAAGAGCATGCACGACCAAGTGGGGTTAAATGTGCTGAAATGGTGCTTCAGAAACCTCTAGACAGA[G/T]AACAACAGCCATTGCTTTCTCTTATTGTCACAGCAGTCGATGGAGGAAACCCAGAAAGATCTGGTAATATGAAAATAGAGGTCACTGTACTAGATGCAAATGACAACGCGCCAGTATTTAACCAGTCCGTTTACAGGGCAGTAATAGCAGAAAATGCACTCAAAGGAACGTTTATAACCAACGTCAATGCAAGTGATGCCGACAGTGGTGCAAATGGATTATTTTATTATAGCTTTGGGAATTTGAAAGTCATTGGTGAGATTTTTAAAATGAACGAAAGCAGCGGTGTTGTTACTCTTAATGGTGTGCTTGATTACGAAAAAGCAAAGAAATATGAATTTGATATTGAAGCAAAGGATCAAGGCGGATTAGGCGATTCTGCTAAAGTAATAATTGACTTAATTGATGTTAATGACAACGCACCTGTTGTAAGTGTCATGTCATTTTCAAGTCCAGTGGCTGAAGATGCACGTATTGGTACAACCATCGCGATATTTAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21719
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025258 Nonsense 725 818 1 1
Genomic Location (Zv9):
Chromosome 10 (position 21762306)
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCGCTGTTTCTTTCCTATTCATCACTTGTGTGGTTGTGATAATATCAGTT[A/T]GAATCTACAGATGGAGACAATCTCGCTTCCTCTATCAGTCCAATCTGCCT
Long Flanking Sequence:
TGACTTTGGATATTATAATCCAAGACCAGAATGACAACGCTCCTCAGGTTCTGTATCCAGTACAGACTGGCGCTTCAGTGGTGGCTGAGATTGTGCCTCGTGCTGCAGATGTTGGATATCTGGTCACTAAAGTGGTGGCTGTTGATGTGGACTCTGGTCAGAATGCCTGGCTCTCCTATAAACTCCAGAAAGCTCCAGACAGAGCGCTGTTTGAAGTGGGTTTACAAAATGGAGAAATAAGAACTGTGCGACAAGTCACTGATAAAGATGCTGTCAAACAAAAACTCACTGTTGTTGTGGAGGATAACGGACAGCCCTCTCGCTCAGCTGCGGTCTCCATTAACGTGGCTGTGGCTGACAGCTTTCCCGAAGTGCTGTCAGAGTTCACAGACTTTACGCATGAGAAACAATATAACGACAGCTTAACTTTTTATTTAGCTCTCGCACTGGCCGCTGTTTCTTTCCTATTCATCACTTGTGTGGTTGTGATAATATCAGTT[A/T]GAATCTACAGATGGAGACAATCTCGCTTCCTCTATCAGTCCAATCTGCCTGTTATTCCGTACTATCCACCGCATTACGCAGACACAGGAGTCACTGGAACTCTGCCGCACGGCTATAATTATGAAGTGTGCATGACGACTGACTCGAGGAAGAGTGACTGTAAGTTTTCTACACTCGGGGGTCAGAGTGTTTTAGTGGTGGACCCAAGTTTTACTCAGAACACGCAGCGCGCAATGAAGGAAAGTCGCTTTTTTAAAGATCCCGAAGACAGTGCCGAAACGGTAAGACTGCATAATATTAAATAAAAATTATGACATAACAATAACATTCAAATACATGCAACAAATGCAAAGTTAGCAGTATTAGAAACAATTTGCCATACGTTAAGTCTATTTACTTTAAGGTTTAATTGGCCAAATGCAATGTGTTACTTAAATTCATAATTCAAATCTTTACAGCATGTAAATGTTCAAACAAAATATATACATGCCAAAAATAAC
Associated Phenotype:
Not determined