Busch Lab

ZMP

zgc:110283

Ensembl ID:
ENSDARG00000043936
ZFIN ID:
ZDB-GENE-050417-72
Description:
hypothetical protein LOC550268 [Source:RefSeq peptide;Acc:NP_001017605]
Human Orthologue:
ANXA1
Human Description:
annexin A1 [Source:HGNC Symbol;Acc:533]
Mouse Orthologue:
Anxa1
Mouse Description:
annexin A1 Gene [Source:MGI Symbol;Acc:MGI:96819]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa38522 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26607
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064512 Essential Splice Site 153 340 6 13
ENSDART00000073926 None None 283 None 11
ENSDART00000131368 None None 35 None 4
ENSDART00000133044 Essential Splice Site 153 198 6 8
ENSDART00000144620 Essential Splice Site 153 198 6 8
Genomic Location (Zv9):
Chromosome 5 (position 67507926)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 64309567
GRCz11 5 64998564
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAAGGACAAACAAGGAGATCACGGCGCTGAAGAATAGTTTCAAAGAAGG[T/G]AGCAAAAATCACATAAATACTACATACCAAAGCAGATTTACTGAATGTGT
Long Flanking Sequence:
TTTTCTGTTTAAAAAAGCTGTCCCAAAAAAAAAAATGCTGGGAAATGCTGGAAACCAGTAGCCATTGACATCCTTAATAGGGAAAAAGGGCACTATGTAAATCAATATATACCAGTGTCAAACATTCTTCAAAATATTTTCTTTTGTGTTCAACAGAAGGAACAAAAAAAACTTAAACACGTTTGGATCAGGTTTTTATTTTTGGGTGAACTATTCCTTTTATATTTCCCAGAGATGGGTTGCGGCTGGAAGGGCATCCGCTGCGTGAAAACATGCTGGATAAGTTGGCGGTTCATTCCGCTGTGGCGACCCCGGATTAATAAAGGGACTAAGCCGACAAGAAAATGAATGATTGAATGTTCCTTTTATAAACAAATGTACTTACATGCATACTTAATTGATACTCAGGGTCTTGGGACAAAAGAGAATGTCCTGAGTGAAATTCTGGGGACAAGGACAAACAAGGAGATCACGGCGCTGAAGAATAGTTTCAAAGAAGG[T/G]AGCAAAAATCACATAAATACTACATACCAAAGCAGATTTACTGAATGTGTAAGCTGCTTTACTTTTTCAGTAACACTTTAGTTTAAGTAATAATTCACATCATTTACTAATGGCTTATTAACTGCCTATTATTAAGACATGAACTGTTCATCAGCACTTATTCAGTGATCTTATTTTACTTCCCCAATCCTACCCAATACCTAAACCCAACTACCTTACTTACTATTAAGCAGCTAATTAGTAGTTTATTGAGCTAAAAGTCTTAGTTAATAATGCAACAAAATAAATCTGACCGCTTTTATGTTGTGCAGTCTATAGAGAGACGCTGGAGGAAGATATTAAACATGATGTTAGTGGAAATCTTGAAAATGTCCTGCTTTCCCTTTGCAAGGTAAAAAAGTGCAATATTGGCGGTGAATTTAATTTGTATGAGTATTGCATATAGGTGATTATTATATGAATTGCATAAACAATTACATATTAATGTTTCCTCAGGCTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38522
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064512 Nonsense 242 340 10 13
ENSDART00000073926 Nonsense 185 283 8 11
ENSDART00000131368 None None 35 None 4
ENSDART00000133044 None None 198 None 8
ENSDART00000144620 None None 198 None 8
Genomic Location (Zv9):
Chromosome 5 (position 67505758)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 64322723
GRCz11 5 64996496
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGAAAATCCACAGTTTTCCAATATTATGGTCAATTTAGTAAAGATGGTT[T/A]GGCCAAAGATCTGCAGAGCGAGCTAAGTGGAGACTTTGAAGACTGCATGA
Long Flanking Sequence:
TGTGTCATTATTCAAAACTTCTTCATTAAAATCTTTGTTGTTGAAAACAAATAATATAAAGTTGGAGATGCGAAATGTGACTACAATTATAGAATCACCCATATATAGCAGTTGTGTTGGTGTGTAACAATTAAACAACATGAACTTAGCATAGTTTGTTGCAATTTGCTAAATATCTGACTTCTCAATACCTGGCCAATCACAGTCATTTATTGTAGACTGTTATCAAGTAAGGATTGTACATTAAAACGCATGAATGATATACGTTCTCGTGTTGTTTCAGGCTCTGTTTGAGGCAGGAAAGAATCGGATTGGTACAGTTTGCTCAGTTCTGATTGACATCCTCACAAACAGGAGTGAAGCTCAGCTGTGCAAAAGTAGGATATTTGACTTTCAGTGTGATATAGCGGTGAAGCCCAGCTAATGTTTACTGAGGAGTTAACAGTGTTATTGAAAATCCACAGTTTTCCAATATTATGGTCAATTTAGTAAAGATGGTT[T/A]GGCCAAAGATCTGCAGAGCGAGCTAAGTGGAGACTTTGAAGACTGCATGATGACGCTGGGTAAATATACTGTACACGTTTTCTTTTCTTTGTTTCTGTGTACTGTATTCATGTGGGTGTTAAAAACAGAAACTAGACAAACGCTTCACTGTCCATCTGAATAAAGGAGGCTTCCTAAAATCTGTTAGCAAGACAGGCCTGTTCTTCCAGCTTTGCATGTTCAGTGTGTTTTCATTCAAATGTCCAAAATGGATCGCATCAGATCCAAGAGTGAATAAATGTAAAACATGTATAAACTGCATTCCCAACAGTGTAATCTCTCTCTTATGTTTTAGTGAAGGTTGCTTGGAATAAACCTGCCTACTTTGCAGAAAAGCTCCAACATGCTATGAAGGTAAAGTTGCAAAGGGTTCATTCATTCATTCATTCATATTCATTCATTCATTCATTCATTCATTCATTCATTCATTCATTCATTCATTCATTCATTCATTTATATAT
Associated Phenotype:
Not determined