Busch Lab

ZMP

arid4a

Ensembl ID:
ENSDARG00000043873
ZFIN ID:
ZDB-GENE-050809-105
Description:
AT-rich interactive domain-containing protein 4A [Source:RefSeq peptide;Acc:NP_001026838]
Human Orthologue:
ARID4A
Human Description:
AT rich interactive domain 4A (RBP1-like) [Source:HGNC Symbol;Acc:9885]
Mouse Orthologue:
Arid4a
Mouse Description:
AT rich interactive domain 4A (RBP1-like) Gene [Source:MGI Symbol;Acc:MGI:2444354]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa45596 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa15044 Essential Splice Site Available for shipment Available now
sa23011 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa45596
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064412 Essential Splice Site 118 1196 6 21
ENSDART00000103228 Essential Splice Site 118 671 6 18
ENSDART00000121564 Essential Splice Site 118 663 6 20
ENSDART00000128291 Essential Splice Site 118 1332 5 24
Genomic Location (Zv9):
Chromosome 17 (position 11277128)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 11259650
GRCz11 17 11413716
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGAACTTCACTTTGTCTTAAAGGCGAAAGACATTTTGCAGAGAGTGAGG[T/C]AAATGAGAACATAAATACATTTACTGTGAGGTGTTGTGCCCGGATCATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15044
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064412 Essential Splice Site 753 1196 20 21
ENSDART00000103228 None None 671 None 18
ENSDART00000121564 None None 663 None 20
ENSDART00000128291 Essential Splice Site 753 1332 19 24
Genomic Location (Zv9):
Chromosome 17 (position 11257040)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 11239562
GRCz11 17 11393628
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGAACAAGRAGAACTTCCGGGATGTATGATTCTGATAGAGGATCTAATGG[T/A]AMGAGCTGCTTGCATCAGAAWRGCACTAATAAAAATCCAAGCACCATCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23011
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064412 Nonsense 1006 1196 21 21
ENSDART00000103228 None None 671 None 18
ENSDART00000121564 None None 663 None 20
ENSDART00000128291 Nonsense 1006 1332 20 24
Genomic Location (Zv9):
Chromosome 17 (position 11255672)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 11238194
GRCz11 17 11392260
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGATGCCTTCTCTTACCAGAGAGGTGCACCTCAAGTTAGAAGCTCCTTG[T/A]CCAGACCTGGAGGATCCAACAACAGTGGCAAACGAGGAAATGATGCCTCA
Associated Phenotype:
Not determined