Busch Lab

ZMP

ftr54

Ensembl ID:
ENSDARG00000043850
ZFIN ID:
ZDB-GENE-070620-19
Description:
Zgc:165577 protein [Source:UniProtKB/TrEMBL;Acc:A5PLE6]
Human Orthologue:
TRIM65
Human Description:
tripartite motif-containing 65 [Source:HGNC Symbol;Acc:27316]
Mouse Orthologue:
Trim65
Mouse Description:
tripartite motif-containing 65 Gene [Source:MGI Symbol;Acc:MGI:2442815]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa34912 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa21741 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3757
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064327 Nonsense 217 445 2 4
Genomic Location (Zv9):
Chromosome 10 (position 26456512)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 25860369
GRCz11 10 25822082
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGCCACCTGAAACGGTCAGCTTTGAGTTTGGTGCTCGTTCTTCTGCTGCT[A/T]GAAAAACCTTTTCTAAGAGACTAAAGAAAAAAATGGATGMTTTCCTTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34912
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064327 Essential Splice Site 243 445 3 4
Genomic Location (Zv9):
Chromosome 10 (position 26456330)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 25860187
GRCz11 10 25821900
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATACAGTTTTTACATGCAGATTAAACTAAATATAAGTTGTCCTCTCTTTA[G/A]TAAAGCGCTACAAAAGTCCAACTGATGGGCCCAGGAACCGGAATGAGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21741
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064327 Nonsense 247 445 3 4
Genomic Location (Zv9):
Chromosome 10 (position 26456318)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 25860175
GRCz11 10 25821888
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATGCAGATTAAACTAAATATAAGTTGTCCTCTCTTTAGTAAAGCGCTAC[A/T]AAAGTCCAACTGATGGGCCCAGGAACCGGAATGAGATCCTGCAATGTATG
Associated Phenotype:
Not determined