Busch Lab

ZMP

si:ch211-45m15.1

Ensembl ID:
ENSDARG00000043847
ZFIN ID:
ZDB-GENE-040724-54
Description:
hypothetical protein LOC556137 [Source:RefSeq peptide;Acc:NP_001038261]
Human Orthologue:
C6orf191
Human Description:
chromosome 6 open reading frame 191 [Source:HGNC Symbol;Acc:21571]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa36940 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3092
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064375 Nonsense 83 174 3 6
Genomic Location (Zv9):
Chromosome 20 (position 2144891)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 2099176
GRCz11 20 2125882
KASP Assay ID:
554-3450.1 (used for ordering genotyping assays)
KASP Sequence:
GCTTGTTAGCACCATTTGACTACACCACACAACCATCATGGCAAAGTCCC[A/T]AATACTTAGGTATGCTAGTGTGGATGCAGTAYGCAGTGTTTACACACTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36940
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064375 Essential Splice Site 143 174 6 6
Genomic Location (Zv9):
Chromosome 20 (position 2137686)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 2091971
GRCz11 20 2118677
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAGCACTGAACTTGAAGTAATCATGGTAATACGCGTGTCTTCTGTCTCGT[A/G]GGCTCGGGGTTATTGATGATGATTTTTGGCGGGCAGCTTCTGGCTTATCG
Associated Phenotype:
Not determined