Busch Lab

ZMP

si:ch211-119c20.2

Ensembl ID:
ENSDARG00000043818
ZFIN ID:
ZDB-GENE-041001-137
Description:
Novel protein similar to human and mouse CASK interacting protein 2 (CASKIN2) [Source:UniProtKB/TrEM
Human Orthologue:
CASKIN1
Human Description:
CASK interacting protein 1 [Source:HGNC Symbol;Acc:20879]
Mouse Orthologue:
Caskin1
Mouse Description:
CASK interacting protein 1 Gene [Source:MGI Symbol;Acc:MGI:2442952]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa35280 Nonsense Mutation detected in F1 DNA Not yet available
sa10728 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35280
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016099 Nonsense 287 1270 9 20
ENSDART00000131883 None None 772 None 6
ENSDART00000135886 Nonsense 256 414 8 11
Genomic Location (Zv9):
Chromosome 12 (position 22104208)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 20629789
GRCz11 12 20751663
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCTTTAGACGCCAGTGGAGCATTGCAGGTGAGAGCTTTGAAGGACTACT[G/A]GAATCTCCACGACCCCACTGCTCTCAACATTCGAGCAGGAGATGTAATCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27945
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016099 Essential Splice Site 304 1270 9 20
ENSDART00000131883 None None 772 None 6
ENSDART00000135886 Essential Splice Site 273 414 8 11
Genomic Location (Zv9):
Chromosome 12 (position 22104262)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 20629843
GRCz11 12 20751717
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTCCACGACCCCACTGCTCTCAACATTCGAGCAGGAGATGTAATCACGG[T/C]AGGCATAAAAGAAATTACGTTTCAAGCAAACACTCCACTATTTTTCACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10728
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016099 Nonsense 486 1270 14 20
ENSDART00000131883 None None 772 None 6
ENSDART00000135886 None None 414 None 11
Genomic Location (Zv9):
Chromosome 12 (position 22123087)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 20648668
GRCz11 12 20770542
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TAGGTGCTCTTGGACGGAGGATTCCTCTGAGCAGCTCCAGACCTGGAGAA[C/T]AACATGTCATCCATCAACAGCTGCTTCTAGATGGCAGGGTGAGAACAAGG
Associated Phenotype:
Not determined