Busch Lab

ZMP

si:ch211-51n14.1

Ensembl ID:
ENSDARG00000043814
ZFIN ID:
ZDB-GENE-041014-160
Description:
Novel protein similar to vertebrate sialyltransferase 7 family [Source:UniProtKB/TrEMBL;Acc:Q5P990]
Human Orthologue:
ST6GALNAC1
Human Description:
ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltran
Mouse Orthologues:
Gm11735, St6galnac1
Mouse Descriptions:
ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltran
predicted gene 11735 Gene [Source:MGI Symbol;Acc:MGI:3713525]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa14762 Essential Splice Site Available for shipment Available now
sa4464 Essential Splice Site F2 line generated Not yet available
sa35279 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa14762
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064334 Essential Splice Site 97 407 None 9
ENSDART00000146762 Essential Splice Site 49 358 None 8
Genomic Location (Zv9):
Chromosome 12 (position 22032179)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 20557760
GRCz11 12 20679634
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTGGGACTTTGAAGATGTCTATTTGCGAGACMGTAATGCAAGAAAACCGG[T/G]AAGTGCTTCTTTTCTAASACCARTTTTACATCACATTGCAGTTTTTCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4464
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064334 Essential Splice Site 152 407 3 9
ENSDART00000146762 Essential Splice Site 104 358 2 8
Genomic Location (Zv9):
Chromosome 12 (position 22032444)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 20558025
GRCz11 12 20679899
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTAGCACACTTTAACAATCCCTTTGGCTTCATGGAGTACAATTACAATGG[T/G]AAACACWGCTCATTACTGGCAGGATTTCWTAGTGCCTTTAGATGTGTAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35279
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064334 Essential Splice Site 316 407 7 9
ENSDART00000146762 Essential Splice Site 268 358 6 8
Genomic Location (Zv9):
Chromosome 12 (position 22037690)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 20563271
GRCz11 12 20685145
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCAGATTTAACGTTCTACACCCCGATTTCCTTCGTTACATTCGCAACAGG[T/C]AACAAAAGTGAACAGTTTGTCAGGTCATTGAACAACCTGAGATCTGCTTC
Associated Phenotype:
Not determined