Busch Lab

ZMP

LOC100334314

Ensembl ID:
ENSDARG00000043799
Human Orthologue:
KLHL29
Human Description:
kelch-like 29 (Drosophila) [Source:HGNC Symbol;Acc:29404]
Mouse Orthologue:
Klhl29
Mouse Description:
kelch-like 29 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2683857]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa36291 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa36292 Nonsense Mutation detected in F1 DNA Not yet available
sa42853 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa16249 Nonsense Available for shipment Available now
sa36293 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa36291
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038730 Essential Splice Site 139 855 2 12
Genomic Location (Zv9):
Chromosome 17 (position 4398683)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 4473427
GRCz11 17 4631542
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGACACAGACGAACCGCCCGCAAAGCAGATGAGGGAGAAAGATATCGCAG[G/A]TAAAAGAAAATCTCTTATTTGCTCTCTTCTTTCTTGCTCGGATTGAGTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36292
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038730 Nonsense 298 855 4 12
Genomic Location (Zv9):
Chromosome 17 (position 4440549)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 4515293
GRCz11 17 4673408
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCGCGTGCAAATCACTGTTTCTCTTCTTTCTCTCGTTCCTACAGAAATGT[T/A]GAAGGAATTGAACCAGCAGCGGAGAGAGAAAGAGTTTACAGACCTGAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42853
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038730 Essential Splice Site 342 855 4 12
Genomic Location (Zv9):
Chromosome 17 (position 4440683)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 4515427
GRCz11 17 4673542
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAATGTTCTAGCTTCCTGCAGCTTGTATTTCAAGGACATGGTGAAAAGG[T/C]TTGCTTGATCTGTCGTCGTCTTCTTTTTCGTAGGGTGCATTTGTGTCGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16249
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038730 Nonsense 595 855 8 12
Genomic Location (Zv9):
Chromosome 17 (position 4534864)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 4609608
GRCz11 17 4767723
KASP Assay ID:
2261-0515.1 (used for ordering genotyping assays)
KASP Sequence:
CATCGCTCTCTGACAGCCGTCACCTGCTTCAACCCTCAGAAMAACAARTG[G/A]TACCCGCTGGCCAGCCTMCCCTTCTACAACCGYGAGTTCTTCTCGGTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36293
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038730 Essential Splice Site 682 855 9 12
Genomic Location (Zv9):
Chromosome 17 (position 4537135)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 4611879
GRCz11 17 4769994
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TACGCCATTGGAGGACTCGGAGCGGCTGGAAATCTGGACAATGTGGAGAG[G/A]TAACATTCAGTCCTGCTGCGCTGTGTGTGAGTGGAGGTGTGTGTTTAGGA
Associated Phenotype:
Not determined