Busch Lab

ZMP

si:dkey-27p1.2

Ensembl ID:
ENSDARG00000043757
ZFIN ID:
ZDB-GENE-091116-1
Human Orthologue:
ROD1
Human Description:
ROD1 regulator of differentiation 1 (S. pombe) [Source:HGNC Symbol;Acc:10253]
Mouse Orthologue:
Rod1
Mouse Description:
ROD1 regulator of differentiation 1 (S. pombe) Gene [Source:MGI Symbol;Acc:MGI:1923334]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa2556 Essential Splice Site F2 line generated Not yet available
sa5581 Essential Splice Site F2 line generated Not yet available

Mutation Details

Allele Name:
sa2556
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040308 Essential Splice Site 208 522 5 13
ENSDART00000146727 Essential Splice Site 208 522 6 14
ENSDART00000040308 Essential Splice Site 208 522 5 13
ENSDART00000146727 Essential Splice Site 208 522 6 14
Genomic Location (Zv9):
Chromosome 10 (position 11140238)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 11216104
GRCz11 10 11174342
KASP Assay ID:
554-3066.1 (used for ordering genotyping assays)
KASP Sequence:
GGCCTTGCTACAATATGCAGATCCAATGAACGCACATCATGCCAAAGTGG[T/G]CAGTATCAACAAACAATCCATAACCACAAGATGCTCCTTTTAATAGCAGA
Long Flanking Sequence:
CTGAAATCAAGAAGCCTTTTTATATAGAAAAGTTAAAAATATCAAAAAATAAAAATAATCTGTTAAAGGGGTTTGTAAAATAATTGTATTATTTACAAGATTAATTTACTCACCTCATTGGCAGATTATTTTGCTTTTATTTTCAGCAATATTTTTTACTTGTCCAGAAAATGCTTCTTGATTTAAGAATTTTGGATATTTGGAATAAGACAAACCTAAGAAAAACCATTTTTTAAGTTTTCTGACTGCTTATCAACTAGCTAAACTACCTCAAAATCATTTTGGAGACTAACTAATCCTGCTCAACCAGATAAGATGAGATTAAATATTATTTTAAAATTGTATATTTTTATTTACAAAGGCTGTTCTTGTCTTCTCCTTAATTTAGATCTTCTCCAAATTTGGAACGGTCCTGAAGATCATCACCTTCACCAAGAACAACCAGTTTCAGGCCTTGCTACAATATGCAGATCCAATGAACGCACATCATGCCAAAGTGG[T/G]CAGTATCAACAAACAATCCATAACCACAAGATGCTCCTTTTAATAGCAGACTGTTTTAGCATTTAATTTGTAAAACAAACACATTTTTACAAACTAGCACTTTTTCCATTAAGTTCTAGTACTTCATTAGCAGCTAGTGCCTGTTATTTAGTACCTTTTAAATAAAAGGTATTTAGCGCATAAATAAAAGGACGTAGAGCAGAACTGCAAGTGCAAAGATGACGCGTCGGTTTCTCACTATAATTCATAGCAGAGTTTTCTTATCCTATGAGAAGAGCCGGCTTCTTAATTACTTATGGCTGCACATGCTGTCCAAAAGCAAGACACAGACCTGCCAGTGCCACTTCCAAGCTGTGAGACCCTATGTTGATGACTGGGTGAGACCGCGTCCACGGACCCACGGCACAGAGTACTTAGCCATTTATGAAGGATTGTATGTGTTTGTTTCCATGATCCACGAGCCTTGTTGCATGTTTTTCCCCACGATCCTGTCAGGGCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5581
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040308 Essential Splice Site 208 522 5 13
ENSDART00000146727 Essential Splice Site 208 522 6 14
ENSDART00000040308 Essential Splice Site 208 522 5 13
ENSDART00000146727 Essential Splice Site 208 522 6 14
Genomic Location (Zv9):
Chromosome 10 (position 11140238)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 11216104
GRCz11 10 11174342
KASP Assay ID:
554-3066.1 (used for ordering genotyping assays)
KASP Sequence:
GGCCTTGCTACAATATGCAGATCCAATGAACGCACATCATGCCAAAGTGG[T/G]CAGTATCAACAAACAATCCATAACCACAAGATGCTCCTTTTAATAGCAGA
Long Flanking Sequence:
CTGAAATCAAGAAGCCTTTTTATATAGAAAAGTTAAAAATATCAAAAAATAAAAATAATCTGTTAAAGGGGTTTGTAAAATAATTGTATTATTTACAAGATTAATTTACTCACCTCATTGGCAGATTATTTTGCTTTTATTTTCAGCAATATTTTTTACTTGTCCAGAAAATGCTTCTTGATTTAAGAATTTTGGATATTTGGAATAAGACAAACCTAAGAAAAACCATTTTTTAAGTTTTCTGACTGCTTATCAACTAGCTAAACTACCTCAAAATCATTTTGGAGACTAACTAATCCTGCTCAACCAGATAAGATGAGATTAAATATTATTTTAAAATTGTATATTTTTATTTACAAAGGCTGTTCTTGTCTTCTCCTTAATTTAGATCTTCTCCAAATTTGGAACGGTCCTGAAGATCATCACCTTCACCAAGAACAACCAGTTTCAGGCCTTGCTACAATATGCAGATCCAATGAACGCACATCATGCCAAAGTGG[T/G]CAGTATCAACAAACAATCCATAACCACAAGATGCTCCTTTTAATAGCAGACTGTTTTAGCATTTAATTTGTAAAACAAACACATTTTTACAAACTAGCACTTTTTCCATTAAGTTCTAGTACTTCATTAGCAGCTAGTGCCTGTTATTTAGTACCTTTTAAATAAAAGGTATTTAGCGCATAAATAAAAGGACGTAGAGCAGAACTGCAAGTGCAAAGATGACGCGTCGGTTTCTCACTATAATTCATAGCAGAGTTTTCTTATCCTATGAGAAGAGCCGGCTTCTTAATTACTTATGGCTGCACATGCTGTCCAAAAGCAAGACACAGACCTGCCAGTGCCACTTCCAAGCTGTGAGACCCTATGTTGATGACTGGGTGAGACCGCGTCCACGGACCCACGGCACAGAGTACTTAGCCATTTATGAAGGATTGTATGTGTTTGTTTCCATGATCCACGAGCCTTGTTGCATGTTTTTCCCCACGATCCTGTCAGGGCCG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2549
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040308 Essential Splice Site 381 522 10 13
ENSDART00000146727 Essential Splice Site 381 522 11 14
Genomic Location (Zv9):
Chromosome 10 (position 11118679)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 11194545
GRCz11 10 11152783
KASP Assay ID:
554-2763.1 (used for ordering genotyping assays)
KASP Sequence:
AAAGAGAATGCTTTAATACAGATGGCGGACGCCACGCAAGCCCAGCTTGG[T/C]ACGTCAGGCTGTACACACAAAGCCTTTTCATCTTGATGTGTTTTCATGCT
Long Flanking Sequence:
TCCCTCTCTCTTACAGAGTATATCGCCACACGAGCTCTTCATTTTATTCGGTAAGGATGAATTTATTTCTCCTCCAGATTAGATGTGCAGACGGCTCTGTTTTATGAAGGCCGCTGAGGATCCAGTCTGAGCAATGAGACCATTTCCTTACAAATACACCGGTGGGAGATTATTTGCAGATTGCGCTTTGTGACCCGTCAAATGAATCTTCCAAAATTTTGCAGTATTGCACGCAGTTATTGTGCCTGCAATTTAATAACTGTCAACATCAGACTGATATCCTGTAAAATCAGTGCGTTTGGTTCTGGCTTTAATAATGAAAGAGCGAGATCTGCGGATCACATATTATTTGCTATAAATCCTGATTGAGCATGAAAATATGAACGTTTCTCTTTTATCCACACAGGAGTTTATGGAGATGTGCACCGAGTGAAGATTCTGTTCAACAAGAAAGAGAATGCTTTAATACAGATGGCGGACGCCACGCAAGCCCAGCTTGG[T/C]ACGTCAGGCTGTACACACAAAGCCTTTTCATCTTGATGTGTTTTCATGCTTTGATCAGTCCTCTTTAAATGCAAGTTCTGTGTCTGTGTTTGAGCTACAAATCCACACGCTTGTAGAAATTACATTTCTCTATTAAAAACGGTTTGTTGTTGTGTGGCTGCATTAAAATATACTGACTGCAGCTTTTAATAGCTAGTGTCTTGTGTAATGTTGGTAGGAGAAATTGAGTCTTTATTTACTTATGAAAGTCCGTGAATGGTTTCTGTTGCGATGCTTGAGAGAGATAATATTAGTTTCGCCAAAAAAATGGATATATTACTTTAATTTAATGGAAAAAATTTAATTTAGAACTTCTGAATTGAGATATTGTATATTTACAGAAATGTTTAAAACAATTCTGATGATACAGCATGCAAAAATCATCACCTTGAAATTAAAAGGTTTTATCTGCGTTCTGAATGGTTTTGAGATAATGAGCTTCAAAGTTTTTGCATTCCATA
Associated Phenotype:
Not determined