Busch Lab

ZMP

cdc45

Ensembl ID:
ENSDARG00000043720
ZFIN ID:
ZDB-GENE-040426-2710
Description:
CDC45-related protein [Source:RefSeq peptide;Acc:NP_998551]
Human Orthologue:
CDC45
Human Description:
cell division cycle 45 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:1739]
Mouse Orthologue:
Cdc45
Mouse Description:
cell division cycle 45 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1338073]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa10592 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa10592
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064201 Essential Splice Site 203 572 None 18

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 4962060)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 4697252
GRCz11 8 4753519
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAGAGAGATTCTMTTTGACTATGAGCAGTACGAGTTTCATGGAACATCAG[T/A]GAGTAATAATTGATCTTTTATAAATATTTCTGATCTTATGCAGAACATGG
Associated Phenotype:
Not determined